FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626665_at:

>probe:Drosophila_2:1626665_at:326:243; Interrogation_Position=2580; Antisense; CAATCAACTGTTCTATCTATCAAAA
>probe:Drosophila_2:1626665_at:624:401; Interrogation_Position=2607; Antisense; GACATTATGGACTTACTTTGTTCGT
>probe:Drosophila_2:1626665_at:35:557; Interrogation_Position=2615; Antisense; GGACTTACTTTGTTCGTCAAAATGA
>probe:Drosophila_2:1626665_at:481:27; Interrogation_Position=2687; Antisense; ATACATTTTCTTGTCCATAGCAGCA
>probe:Drosophila_2:1626665_at:350:645; Interrogation_Position=2695; Antisense; TCTTGTCCATAGCAGCATGTAGAAC
>probe:Drosophila_2:1626665_at:101:425; Interrogation_Position=2769; Antisense; GAGTTAAGAAATAGTTGTCCTTCCA
>probe:Drosophila_2:1626665_at:32:249; Interrogation_Position=2817; Antisense; CAATCTCAATTTTCGCTTTAGGCAT
>probe:Drosophila_2:1626665_at:259:225; Interrogation_Position=2958; Antisense; AAGGAGACGTCTTTCTTTGCCAGAA
>probe:Drosophila_2:1626665_at:645:407; Interrogation_Position=2963; Antisense; GACGTCTTTCTTTGCCAGAAATATG
>probe:Drosophila_2:1626665_at:550:389; Interrogation_Position=3007; Antisense; GAAAAACATCATCTGCCTGAGAATC
>probe:Drosophila_2:1626665_at:647:271; Interrogation_Position=3016; Antisense; CATCTGCCTGAGAATCATATTTTAT
>probe:Drosophila_2:1626665_at:648:219; Interrogation_Position=3065; Antisense; AAGTGTTTCAAAGTCAATCCATTTA
>probe:Drosophila_2:1626665_at:699:217; Interrogation_Position=3075; Antisense; AAGTCAATCCATTTACTGAACTATA
>probe:Drosophila_2:1626665_at:679:31; Interrogation_Position=3136; Antisense; ATAAGTGCGATTCCGTGAATTACAA

Paste this into a BLAST search page for me
CAATCAACTGTTCTATCTATCAAAAGACATTATGGACTTACTTTGTTCGTGGACTTACTTTGTTCGTCAAAATGAATACATTTTCTTGTCCATAGCAGCATCTTGTCCATAGCAGCATGTAGAACGAGTTAAGAAATAGTTGTCCTTCCACAATCTCAATTTTCGCTTTAGGCATAAGGAGACGTCTTTCTTTGCCAGAAGACGTCTTTCTTTGCCAGAAATATGGAAAAACATCATCTGCCTGAGAATCCATCTGCCTGAGAATCATATTTTATAAGTGTTTCAAAGTCAATCCATTTAAAGTCAATCCATTTACTGAACTATAATAAGTGCGATTCCGTGAATTACAA

Full Affymetrix probeset data:

Annotations for 1626665_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720