FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626667_at:

>probe:Drosophila_2:1626667_at:154:411; Interrogation_Position=1375; Antisense; GACGCGACGGTCTAAACACAGATCC
>probe:Drosophila_2:1626667_at:630:255; Interrogation_Position=1391; Antisense; CACAGATCCATCGTAGTTGCAGTGT
>probe:Drosophila_2:1626667_at:447:617; Interrogation_Position=1408; Antisense; TGCAGTGTAGGCAATTGGCATTTTA
>probe:Drosophila_2:1626667_at:157:1; Interrogation_Position=1436; Antisense; TAGTTTACAACTCACTTCTACCGGG
>probe:Drosophila_2:1626667_at:248:1; Interrogation_Position=1451; Antisense; TTCTACCGGGTACAATTAACATATA
>probe:Drosophila_2:1626667_at:37:351; Interrogation_Position=1519; Antisense; GCAGACATACTTACATACTTACATT
>probe:Drosophila_2:1626667_at:246:209; Interrogation_Position=1656; Antisense; AAGCAGTTTTACAACCATACCCGTG
>probe:Drosophila_2:1626667_at:604:27; Interrogation_Position=1672; Antisense; ATACCCGTGCATTCACAACTACGAA
>probe:Drosophila_2:1626667_at:513:423; Interrogation_Position=1710; Antisense; GAGAACAACAGCTCAGTCACAGCAT
>probe:Drosophila_2:1626667_at:153:495; Interrogation_Position=1725; Antisense; GTCACAGCATTCAAATTCATAGTAT
>probe:Drosophila_2:1626667_at:130:365; Interrogation_Position=1750; Antisense; GAATTTTATACACATCATCCGTAGG
>probe:Drosophila_2:1626667_at:453:525; Interrogation_Position=1774; Antisense; GGGCAGTTATCTTCTTTAAGTCTTT
>probe:Drosophila_2:1626667_at:528:73; Interrogation_Position=1809; Antisense; AGGAACAGCATGAAAGCGACTCCCC
>probe:Drosophila_2:1626667_at:579:477; Interrogation_Position=1852; Antisense; GTTTACGTACGTATACAACACAAGA

Paste this into a BLAST search page for me
GACGCGACGGTCTAAACACAGATCCCACAGATCCATCGTAGTTGCAGTGTTGCAGTGTAGGCAATTGGCATTTTATAGTTTACAACTCACTTCTACCGGGTTCTACCGGGTACAATTAACATATAGCAGACATACTTACATACTTACATTAAGCAGTTTTACAACCATACCCGTGATACCCGTGCATTCACAACTACGAAGAGAACAACAGCTCAGTCACAGCATGTCACAGCATTCAAATTCATAGTATGAATTTTATACACATCATCCGTAGGGGGCAGTTATCTTCTTTAAGTCTTTAGGAACAGCATGAAAGCGACTCCCCGTTTACGTACGTATACAACACAAGA

Full Affymetrix probeset data:

Annotations for 1626667_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720