FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626670_at:

>probe:Drosophila_2:1626670_at:418:501; Interrogation_Position=1052; Antisense; GTCGCTTTGTGCTTGTGGGCATAAC
>probe:Drosophila_2:1626670_at:100:343; Interrogation_Position=1070; Antisense; GCATAACCAGTGCAGGCTTCGGCTG
>probe:Drosophila_2:1626670_at:113:343; Interrogation_Position=1085; Antisense; GCTTCGGCTGCGGAGTAGATCATCA
>probe:Drosophila_2:1626670_at:24:613; Interrogation_Position=1151; Antisense; TACAGGAAGTGGTGGCCCGCAACGA
>probe:Drosophila_2:1626670_at:553:201; Interrogation_Position=585; Antisense; AACCGTGTACCTGGGAGAGCTGGAC
>probe:Drosophila_2:1626670_at:227:121; Interrogation_Position=602; Antisense; AGCTGGACACGCAGGATCTGGGTCA
>probe:Drosophila_2:1626670_at:672:39; Interrogation_Position=617; Antisense; ATCTGGGTCACATACACGAACCGCT
>probe:Drosophila_2:1626670_at:701:617; Interrogation_Position=662; Antisense; TGCTACAGAAGATCATCCATCCGCG
>probe:Drosophila_2:1626670_at:695:123; Interrogation_Position=746; Antisense; AGCCGACGTCCTTTACGGAGCACAT
>probe:Drosophila_2:1626670_at:226:47; Interrogation_Position=794; Antisense; ATCCGATCCGGCTGATTGGGCGCAA
>probe:Drosophila_2:1626670_at:651:253; Interrogation_Position=873; Antisense; CAACATGCTGCAAGTCGCCAGTGTT
>probe:Drosophila_2:1626670_at:600:659; Interrogation_Position=905; Antisense; TAACCACACTGGATTGCATTCGCTG
>probe:Drosophila_2:1626670_at:208:71; Interrogation_Position=962; Antisense; AGGCCGAAATGTTTTGCGCCGGACA
>probe:Drosophila_2:1626670_at:361:67; Interrogation_Position=992; Antisense; ATGGACACATGGATGCCTGCTTGGG

Paste this into a BLAST search page for me
GTCGCTTTGTGCTTGTGGGCATAACGCATAACCAGTGCAGGCTTCGGCTGGCTTCGGCTGCGGAGTAGATCATCATACAGGAAGTGGTGGCCCGCAACGAAACCGTGTACCTGGGAGAGCTGGACAGCTGGACACGCAGGATCTGGGTCAATCTGGGTCACATACACGAACCGCTTGCTACAGAAGATCATCCATCCGCGAGCCGACGTCCTTTACGGAGCACATATCCGATCCGGCTGATTGGGCGCAACAACATGCTGCAAGTCGCCAGTGTTTAACCACACTGGATTGCATTCGCTGAGGCCGAAATGTTTTGCGCCGGACAATGGACACATGGATGCCTGCTTGGG

Full Affymetrix probeset data:

Annotations for 1626670_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720