FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626672_at:

>probe:Drosophila_2:1626672_at:128:349; Interrogation_Position=102; Antisense; GCAGAATCGCGACAAAGAAAGCGTC
>probe:Drosophila_2:1626672_at:130:391; Interrogation_Position=118; Antisense; GAAAGCGTCAAGTCCATTCTGGGTC
>probe:Drosophila_2:1626672_at:700:327; Interrogation_Position=122; Antisense; GCGTCAAGTCCATTCTGGGTCGCCA
>probe:Drosophila_2:1626672_at:618:639; Interrogation_Position=135; Antisense; TCTGGGTCGCCACACAAAGATACTG
>probe:Drosophila_2:1626672_at:315:503; Interrogation_Position=140; Antisense; GTCGCCACACAAAGATACTGGTCAA
>probe:Drosophila_2:1626672_at:664:669; Interrogation_Position=155; Antisense; TACTGGTCAAGTATATGGTCAAATT
>probe:Drosophila_2:1626672_at:64:511; Interrogation_Position=17; Antisense; GTGAAATGCGCACCATGGAGATGAT
>probe:Drosophila_2:1626672_at:22:493; Interrogation_Position=172; Antisense; GTCAAATTGGAGACGAAAGGCGATA
>probe:Drosophila_2:1626672_at:694:653; Interrogation_Position=195; Antisense; TAAGACGGAGAATCGTGTTCTGTGA
>probe:Drosophila_2:1626672_at:380:425; Interrogation_Position=34; Antisense; GAGATGATGACTCACATCGACCAGT
>probe:Drosophila_2:1626672_at:320:445; Interrogation_Position=39; Antisense; GATGACTCACATCGACCAGTACCTG
>probe:Drosophila_2:1626672_at:628:623; Interrogation_Position=62; Antisense; TGCGCCGCATCATCGAGCTGCAGAT
>probe:Drosophila_2:1626672_at:508:647; Interrogation_Position=71; Antisense; TCATCGAGCTGCAGATACGGGACGT
>probe:Drosophila_2:1626672_at:577:617; Interrogation_Position=80; Antisense; TGCAGATACGGGACGTGGTCAAGCA

Paste this into a BLAST search page for me
GCAGAATCGCGACAAAGAAAGCGTCGAAAGCGTCAAGTCCATTCTGGGTCGCGTCAAGTCCATTCTGGGTCGCCATCTGGGTCGCCACACAAAGATACTGGTCGCCACACAAAGATACTGGTCAATACTGGTCAAGTATATGGTCAAATTGTGAAATGCGCACCATGGAGATGATGTCAAATTGGAGACGAAAGGCGATATAAGACGGAGAATCGTGTTCTGTGAGAGATGATGACTCACATCGACCAGTGATGACTCACATCGACCAGTACCTGTGCGCCGCATCATCGAGCTGCAGATTCATCGAGCTGCAGATACGGGACGTTGCAGATACGGGACGTGGTCAAGCA

Full Affymetrix probeset data:

Annotations for 1626672_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720