FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626674_at:

>probe:Drosophila_2:1626674_at:76:197; Interrogation_Position=106; Antisense; AACTGGTTGGCATCCGCAGATTCCA
>probe:Drosophila_2:1626674_at:637:455; Interrogation_Position=124; Antisense; GATTCCATTCAACTTACCCAACGAG
>probe:Drosophila_2:1626674_at:498:429; Interrogation_Position=146; Antisense; GAGTATGTGCCTGCTATCCGATCAA
>probe:Drosophila_2:1626674_at:87:399; Interrogation_Position=18; Antisense; GACAAAGGTTGCTTCTACTGCTGCC
>probe:Drosophila_2:1626674_at:554:433; Interrogation_Position=198; Antisense; GAGTGGACCAGTTCGATCCAGTGGA
>probe:Drosophila_2:1626674_at:530:73; Interrogation_Position=270; Antisense; AGGAAGAGATTTTGCCCACCTCACG
>probe:Drosophila_2:1626674_at:579:185; Interrogation_Position=302; Antisense; AACAAGTACGGTCCGGCAGATCCGA
>probe:Drosophila_2:1626674_at:412:667; Interrogation_Position=33; Antisense; TACTGCTGCCATTTGTGGCCATTGT
>probe:Drosophila_2:1626674_at:503:685; Interrogation_Position=376; Antisense; TATCGTAGACAATCAGCAGCCCAAA
>probe:Drosophila_2:1626674_at:25:137; Interrogation_Position=412; Antisense; ACGTTACTTCGTCATTTCGCAGGAC
>probe:Drosophila_2:1626674_at:31:173; Interrogation_Position=447; Antisense; AAAGAGTTTCTTTCAGCTCCCAGCA
>probe:Drosophila_2:1626674_at:164:699; Interrogation_Position=497; Antisense; TTTACGGCTCAGTTGACTTACTCCA
>probe:Drosophila_2:1626674_at:167:527; Interrogation_Position=527; Antisense; GGGCAACTCAAGGATCCTGTGTATC
>probe:Drosophila_2:1626674_at:260:25; Interrogation_Position=89; Antisense; ATAGCACCTTATGCACCAACTGGTT

Paste this into a BLAST search page for me
AACTGGTTGGCATCCGCAGATTCCAGATTCCATTCAACTTACCCAACGAGGAGTATGTGCCTGCTATCCGATCAAGACAAAGGTTGCTTCTACTGCTGCCGAGTGGACCAGTTCGATCCAGTGGAAGGAAGAGATTTTGCCCACCTCACGAACAAGTACGGTCCGGCAGATCCGATACTGCTGCCATTTGTGGCCATTGTTATCGTAGACAATCAGCAGCCCAAAACGTTACTTCGTCATTTCGCAGGACAAAGAGTTTCTTTCAGCTCCCAGCATTTACGGCTCAGTTGACTTACTCCAGGGCAACTCAAGGATCCTGTGTATCATAGCACCTTATGCACCAACTGGTT

Full Affymetrix probeset data:

Annotations for 1626674_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720