FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626675_at:

>probe:Drosophila_2:1626675_at:409:109; Interrogation_Position=1693; Antisense; AGAAGTACCTGCCATGGCGACGTTA
>probe:Drosophila_2:1626675_at:72:469; Interrogation_Position=1714; Antisense; GTTACGCCCTGGATACCAATGACAT
>probe:Drosophila_2:1626675_at:560:127; Interrogation_Position=1728; Antisense; ACCAATGACATTGGCCAGCCGGAGA
>probe:Drosophila_2:1626675_at:5:677; Interrogation_Position=1829; Antisense; TAGCAAGCTAACAGCTCTAGCGGAT
>probe:Drosophila_2:1626675_at:262:155; Interrogation_Position=1839; Antisense; ACAGCTCTAGCGGATCAGAATGATG
>probe:Drosophila_2:1626675_at:31:233; Interrogation_Position=1868; Antisense; AATGAATCCAGATGCCTTATCGGGC
>probe:Drosophila_2:1626675_at:730:213; Interrogation_Position=1903; Antisense; AAGATGAACTGCAGCGCGTGGCTGA
>probe:Drosophila_2:1626675_at:335:113; Interrogation_Position=1915; Antisense; AGCGCGTGGCTGAGGAAAACAAAAC
>probe:Drosophila_2:1626675_at:355:385; Interrogation_Position=1943; Antisense; GAAAGCCAAACTAAGGACTACAGTA
>probe:Drosophila_2:1626675_at:226:237; Interrogation_Position=2039; Antisense; AATCGATTAGGTGCCATTTCTAACC
>probe:Drosophila_2:1626675_at:44:309; Interrogation_Position=2052; Antisense; CCATTTCTAACCTCATCTCATATTT
>probe:Drosophila_2:1626675_at:644:599; Interrogation_Position=2129; Antisense; TGTACTTTGTTAATCGAATATGCTC
>probe:Drosophila_2:1626675_at:377:235; Interrogation_Position=2140; Antisense; AATCGAATATGCTCGTTATCAAAAA
>probe:Drosophila_2:1626675_at:338:25; Interrogation_Position=2241; Antisense; ATAGATCTATCGCATGTTCATTTAA

Paste this into a BLAST search page for me
AGAAGTACCTGCCATGGCGACGTTAGTTACGCCCTGGATACCAATGACATACCAATGACATTGGCCAGCCGGAGATAGCAAGCTAACAGCTCTAGCGGATACAGCTCTAGCGGATCAGAATGATGAATGAATCCAGATGCCTTATCGGGCAAGATGAACTGCAGCGCGTGGCTGAAGCGCGTGGCTGAGGAAAACAAAACGAAAGCCAAACTAAGGACTACAGTAAATCGATTAGGTGCCATTTCTAACCCCATTTCTAACCTCATCTCATATTTTGTACTTTGTTAATCGAATATGCTCAATCGAATATGCTCGTTATCAAAAAATAGATCTATCGCATGTTCATTTAA

Full Affymetrix probeset data:

Annotations for 1626675_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720