Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626676_at:

>probe:Drosophila_2:1626676_at:229:545; Interrogation_Position=6407; Antisense; GGATCAGATTATGGAATCACTTGAA
>probe:Drosophila_2:1626676_at:438:13; Interrogation_Position=6438; Antisense; ATTAATTGCCGAAAGATGCATCTTT
>probe:Drosophila_2:1626676_at:340:441; Interrogation_Position=6452; Antisense; GATGCATCTTTCACGAAAATTAGGA
>probe:Drosophila_2:1626676_at:526:241; Interrogation_Position=6469; Antisense; AATTAGGAAATGTTGCTGCTACACT
>probe:Drosophila_2:1626676_at:78:229; Interrogation_Position=6477; Antisense; AATGTTGCTGCTACACTAGATGGTG
>probe:Drosophila_2:1626676_at:514:339; Interrogation_Position=6486; Antisense; GCTACACTAGATGGTGATTGCACAT
>probe:Drosophila_2:1626676_at:626:533; Interrogation_Position=6498; Antisense; GGTGATTGCACATCTAATTGCTGAC
>probe:Drosophila_2:1626676_at:595:355; Interrogation_Position=6505; Antisense; GCACATCTAATTGCTGACATCAATA
>probe:Drosophila_2:1626676_at:82:169; Interrogation_Position=6622; Antisense; AAATGTATGGACTTATACGTATGTA
>probe:Drosophila_2:1626676_at:582:669; Interrogation_Position=6637; Antisense; TACGTATGTAAGAGAAGCCGGCTTT
>probe:Drosophila_2:1626676_at:407:423; Interrogation_Position=6648; Antisense; GAGAAGCCGGCTTTGTATTATAAGA
>probe:Drosophila_2:1626676_at:600:481; Interrogation_Position=6662; Antisense; GTATTATAAGAACTATGCCCTATCG
>probe:Drosophila_2:1626676_at:245:385; Interrogation_Position=6671; Antisense; GAACTATGCCCTATCGATCTTATTA
>probe:Drosophila_2:1626676_at:369:321; Interrogation_Position=6678; Antisense; GCCCTATCGATCTTATTACGAAGAA

Paste this into a BLAST search page for me
GGATCAGATTATGGAATCACTTGAAATTAATTGCCGAAAGATGCATCTTTGATGCATCTTTCACGAAAATTAGGAAATTAGGAAATGTTGCTGCTACACTAATGTTGCTGCTACACTAGATGGTGGCTACACTAGATGGTGATTGCACATGGTGATTGCACATCTAATTGCTGACGCACATCTAATTGCTGACATCAATAAAATGTATGGACTTATACGTATGTATACGTATGTAAGAGAAGCCGGCTTTGAGAAGCCGGCTTTGTATTATAAGAGTATTATAAGAACTATGCCCTATCGGAACTATGCCCTATCGATCTTATTAGCCCTATCGATCTTATTACGAAGAA

Full Affymetrix probeset data:

Annotations for 1626676_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime