Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626678_at:

>probe:Drosophila_2:1626678_at:467:645; Interrogation_Position=1049; Antisense; TCAGAAAGCGCGAAGCCTACGGTTT
>probe:Drosophila_2:1626678_at:315:665; Interrogation_Position=1066; Antisense; TACGGTTTCTTTGTGGCTTTCGGAT
>probe:Drosophila_2:1626678_at:313:463; Interrogation_Position=1088; Antisense; GATTCTTCCCGCTGATGAGCATGAT
>probe:Drosophila_2:1626678_at:585:519; Interrogation_Position=1117; Antisense; GTGGACTCCGAGGACAACTCACTGA
>probe:Drosophila_2:1626678_at:156:137; Interrogation_Position=1151; Antisense; ACGACGAGACATTCGCCAGGCAGAA
>probe:Drosophila_2:1626678_at:562:221; Interrogation_Position=1174; Antisense; AAGGTGCAGCTCATGTTCGAAGGAA
>probe:Drosophila_2:1626678_at:595:371; Interrogation_Position=1192; Antisense; GAAGGAAACACTCGCACGCTGGAGA
>probe:Drosophila_2:1626678_at:607:331; Interrogation_Position=1209; Antisense; GCTGGAGAGCCTCAAGTGCACCTTG
>probe:Drosophila_2:1626678_at:650:509; Interrogation_Position=1224; Antisense; GTGCACCTTGAAACGTCTGGACGAG
>probe:Drosophila_2:1626678_at:153:391; Interrogation_Position=1251; Antisense; GAAACTGTTCGACTAGGCGGTATAT
>probe:Drosophila_2:1626678_at:728:271; Interrogation_Position=918; Antisense; CTTGGAACTGGAGGTGCTACGTGAC
>probe:Drosophila_2:1626678_at:383:553; Interrogation_Position=951; Antisense; GGAGCTTGTCGACATCTACTACAGG
>probe:Drosophila_2:1626678_at:640:503; Interrogation_Position=975; Antisense; GTCCCTGGTGGACTGCCTGAAGCAT
>probe:Drosophila_2:1626678_at:263:377; Interrogation_Position=993; Antisense; GAAGCATCTGCCCTGGTCCAAGGAG

Paste this into a BLAST search page for me
TCAGAAAGCGCGAAGCCTACGGTTTTACGGTTTCTTTGTGGCTTTCGGATGATTCTTCCCGCTGATGAGCATGATGTGGACTCCGAGGACAACTCACTGAACGACGAGACATTCGCCAGGCAGAAAAGGTGCAGCTCATGTTCGAAGGAAGAAGGAAACACTCGCACGCTGGAGAGCTGGAGAGCCTCAAGTGCACCTTGGTGCACCTTGAAACGTCTGGACGAGGAAACTGTTCGACTAGGCGGTATATCTTGGAACTGGAGGTGCTACGTGACGGAGCTTGTCGACATCTACTACAGGGTCCCTGGTGGACTGCCTGAAGCATGAAGCATCTGCCCTGGTCCAAGGAG

Full Affymetrix probeset data:

Annotations for 1626678_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime