FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626679_at:

>probe:Drosophila_2:1626679_at:610:665; Interrogation_Position=242; Antisense; TACAAGGTGCAGGAGTGTATCGCCG
>probe:Drosophila_2:1626679_at:681:431; Interrogation_Position=254; Antisense; GAGTGTATCGCCGAGACGGGCGACT
>probe:Drosophila_2:1626679_at:170:103; Interrogation_Position=267; Antisense; AGACGGGCGACTGGAGGGCTTGCCA
>probe:Drosophila_2:1626679_at:402:223; Interrogation_Position=296; Antisense; AAGGTGAAAGAGTTCCGGGCGTGCA
>probe:Drosophila_2:1626679_at:464:93; Interrogation_Position=306; Antisense; AGTTCCGGGCGTGCATGCAGAAGTA
>probe:Drosophila_2:1626679_at:125:631; Interrogation_Position=309; Antisense; TCCGGGCGTGCATGCAGAAGTACGT
>probe:Drosophila_2:1626679_at:469:291; Interrogation_Position=315; Antisense; CGTGCATGCAGAAGTACGTGGAGCA
>probe:Drosophila_2:1626679_at:100:91; Interrogation_Position=327; Antisense; AGTACGTGGAGCAGCAGAGCCAGAA
>probe:Drosophila_2:1626679_at:377:103; Interrogation_Position=342; Antisense; AGAGCCAGAAGTATGCCCACGTCAA
>probe:Drosophila_2:1626679_at:100:127; Interrogation_Position=344; Antisense; AGCCAGAAGTATGCCCACGTCAAGT
>probe:Drosophila_2:1626679_at:510:109; Interrogation_Position=348; Antisense; AGAAGTATGCCCACGTCAAGTAGCA
>probe:Drosophila_2:1626679_at:423:683; Interrogation_Position=353; Antisense; TATGCCCACGTCAAGTAGCATCCTG
>probe:Drosophila_2:1626679_at:723:321; Interrogation_Position=356; Antisense; GCCCACGTCAAGTAGCATCCTGCAG
>probe:Drosophila_2:1626679_at:248:259; Interrogation_Position=359; Antisense; CACGTCAAGTAGCATCCTGCAGAAG

Paste this into a BLAST search page for me
TACAAGGTGCAGGAGTGTATCGCCGGAGTGTATCGCCGAGACGGGCGACTAGACGGGCGACTGGAGGGCTTGCCAAAGGTGAAAGAGTTCCGGGCGTGCAAGTTCCGGGCGTGCATGCAGAAGTATCCGGGCGTGCATGCAGAAGTACGTCGTGCATGCAGAAGTACGTGGAGCAAGTACGTGGAGCAGCAGAGCCAGAAAGAGCCAGAAGTATGCCCACGTCAAAGCCAGAAGTATGCCCACGTCAAGTAGAAGTATGCCCACGTCAAGTAGCATATGCCCACGTCAAGTAGCATCCTGGCCCACGTCAAGTAGCATCCTGCAGCACGTCAAGTAGCATCCTGCAGAAG

Full Affymetrix probeset data:

Annotations for 1626679_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720