FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626680_at:

>probe:Drosophila_2:1626680_at:50:65; Interrogation_Position=1733; Antisense; ATGTGGCGGCCATTAAGCAGGAAAA
>probe:Drosophila_2:1626680_at:480:157; Interrogation_Position=1775; Antisense; AAACGAGTAGTCATTTGCCAACGGG
>probe:Drosophila_2:1626680_at:704:227; Interrogation_Position=1822; Antisense; AATGGCCTCCTCATGGATGATCCGG
>probe:Drosophila_2:1626680_at:574:443; Interrogation_Position=1900; Antisense; GATGATGGTACCCTAAGCTATGTCA
>probe:Drosophila_2:1626680_at:710:115; Interrogation_Position=1915; Antisense; AGCTATGTCAGCGACGTCGAACCCG
>probe:Drosophila_2:1626680_at:417:55; Interrogation_Position=2003; Antisense; ATGAACTTATAACGCCGGATGACCC
>probe:Drosophila_2:1626680_at:558:499; Interrogation_Position=2037; Antisense; GTCCACTACCGAACCGGATATCGAA
>probe:Drosophila_2:1626680_at:629:161; Interrogation_Position=2063; Antisense; AAATTCTCGCCGAGCTTGCGGAAGG
>probe:Drosophila_2:1626680_at:677:721; Interrogation_Position=2078; Antisense; TTGCGGAAGGATCTCTGGCTCTCGT
>probe:Drosophila_2:1626680_at:82:637; Interrogation_Position=2099; Antisense; TCGTCTCGTCCTTGGATCCAGAGCA
>probe:Drosophila_2:1626680_at:477:355; Interrogation_Position=2121; Antisense; GCACGAGGATCGTGTGCTCAACGAA
>probe:Drosophila_2:1626680_at:365:509; Interrogation_Position=2134; Antisense; GTGCTCAACGAAATCTACATGCTGG
>probe:Drosophila_2:1626680_at:87:327; Interrogation_Position=2171; Antisense; GCGAGTTGTGCGAAACGCCTCTGAA
>probe:Drosophila_2:1626680_at:129:353; Interrogation_Position=2235; Antisense; GCAGCCAGAGGACTAACGACATTTT

Paste this into a BLAST search page for me
ATGTGGCGGCCATTAAGCAGGAAAAAAACGAGTAGTCATTTGCCAACGGGAATGGCCTCCTCATGGATGATCCGGGATGATGGTACCCTAAGCTATGTCAAGCTATGTCAGCGACGTCGAACCCGATGAACTTATAACGCCGGATGACCCGTCCACTACCGAACCGGATATCGAAAAATTCTCGCCGAGCTTGCGGAAGGTTGCGGAAGGATCTCTGGCTCTCGTTCGTCTCGTCCTTGGATCCAGAGCAGCACGAGGATCGTGTGCTCAACGAAGTGCTCAACGAAATCTACATGCTGGGCGAGTTGTGCGAAACGCCTCTGAAGCAGCCAGAGGACTAACGACATTTT

Full Affymetrix probeset data:

Annotations for 1626680_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720