FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626683_at:

>probe:Drosophila_2:1626683_at:550:77; Interrogation_Position=3672; Antisense; AGGTACTGTGCAACCTGGTCGGTGC
>probe:Drosophila_2:1626683_at:447:591; Interrogation_Position=3687; Antisense; TGGTCGGTGCACAGGCTGCCAAACG
>probe:Drosophila_2:1626683_at:659:657; Interrogation_Position=3721; Antisense; TAAGGTTTTCGATGCCCTGCAGAAT
>probe:Drosophila_2:1626683_at:522:45; Interrogation_Position=3744; Antisense; ATCCCGCCTACAACAAGCAGCTATT
>probe:Drosophila_2:1626683_at:313:671; Interrogation_Position=3770; Antisense; TACGAGCTGCTGGAGATACTTATGA
>probe:Drosophila_2:1626683_at:373:465; Interrogation_Position=3793; Antisense; GATTGAGTTCTTTCCTGAAATCCGA
>probe:Drosophila_2:1626683_at:472:395; Interrogation_Position=3809; Antisense; GAAATCCGACAATTGCGCGTCAGCA
>probe:Drosophila_2:1626683_at:625:623; Interrogation_Position=3822; Antisense; TGCGCGTCAGCAACTCCAATGGAAC
>probe:Drosophila_2:1626683_at:78:165; Interrogation_Position=3853; Antisense; AAATACGGCTACTGCTGGAGCGGCA
>probe:Drosophila_2:1626683_at:556:625; Interrogation_Position=3927; Antisense; TGCCCTCGCTTAATCATAGTGGTGG
>probe:Drosophila_2:1626683_at:624:181; Interrogation_Position=3981; Antisense; AAAACCATCAGGGATCCTCGTCGGC
>probe:Drosophila_2:1626683_at:72:263; Interrogation_Position=4006; Antisense; CAGCGGATCCTCAGCTGGCGCGAGT
>probe:Drosophila_2:1626683_at:672:259; Interrogation_Position=4112; Antisense; CACCATTCGCAAGCGGGCAGTTCGA
>probe:Drosophila_2:1626683_at:446:711; Interrogation_Position=4231; Antisense; TTCAATGTTTAATGCTCTCCCTCTT

Paste this into a BLAST search page for me
AGGTACTGTGCAACCTGGTCGGTGCTGGTCGGTGCACAGGCTGCCAAACGTAAGGTTTTCGATGCCCTGCAGAATATCCCGCCTACAACAAGCAGCTATTTACGAGCTGCTGGAGATACTTATGAGATTGAGTTCTTTCCTGAAATCCGAGAAATCCGACAATTGCGCGTCAGCATGCGCGTCAGCAACTCCAATGGAACAAATACGGCTACTGCTGGAGCGGCATGCCCTCGCTTAATCATAGTGGTGGAAAACCATCAGGGATCCTCGTCGGCCAGCGGATCCTCAGCTGGCGCGAGTCACCATTCGCAAGCGGGCAGTTCGATTCAATGTTTAATGCTCTCCCTCTT

Full Affymetrix probeset data:

Annotations for 1626683_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720