FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626684_at:

>probe:Drosophila_2:1626684_at:112:621; Interrogation_Position=106; Antisense; TGCTCCTCTGTCTATGCTTTTTGAT
>probe:Drosophila_2:1626684_at:271:461; Interrogation_Position=128; Antisense; GATTTTCGGCGATCTCATCTACATA
>probe:Drosophila_2:1626684_at:287:417; Interrogation_Position=183; Antisense; GAGCGTCGCAACTACACGGGCAAAA
>probe:Drosophila_2:1626684_at:318:591; Interrogation_Position=214; Antisense; TGGTCATCCAACACCGATCACAGGA
>probe:Drosophila_2:1626684_at:227:709; Interrogation_Position=295; Antisense; TTGAATTGGACTACACCCTGGGACG
>probe:Drosophila_2:1626684_at:498:589; Interrogation_Position=313; Antisense; TGGGACGCAAGATCACTTTCTTTTG
>probe:Drosophila_2:1626684_at:116:225; Interrogation_Position=378; Antisense; AAGGATGGCGCAGAGCTCTACCAAC
>probe:Drosophila_2:1626684_at:718:187; Interrogation_Position=400; Antisense; AACACCGATTCTTTCAGGTACACGA
>probe:Drosophila_2:1626684_at:262:547; Interrogation_Position=485; Antisense; GGATGCTGGTTTCTACGAGTGTCAA
>probe:Drosophila_2:1626684_at:277:207; Interrogation_Position=508; Antisense; AAGCGGACAATATCTATGCCATCGA
>probe:Drosophila_2:1626684_at:156:49; Interrogation_Position=523; Antisense; ATGCCATCGATCGTCGAGGTTTTCG
>probe:Drosophila_2:1626684_at:106:435; Interrogation_Position=538; Antisense; GAGGTTTTCGCACGGACTACGTTAT
>probe:Drosophila_2:1626684_at:84:175; Interrogation_Position=578; Antisense; AAAGCCCACTTTTCAGCCATTACAA
>probe:Drosophila_2:1626684_at:90:601; Interrogation_Position=87; Antisense; TGTAATCTTCATCGGATCGTGCTCC

Paste this into a BLAST search page for me
TGCTCCTCTGTCTATGCTTTTTGATGATTTTCGGCGATCTCATCTACATAGAGCGTCGCAACTACACGGGCAAAATGGTCATCCAACACCGATCACAGGATTGAATTGGACTACACCCTGGGACGTGGGACGCAAGATCACTTTCTTTTGAAGGATGGCGCAGAGCTCTACCAACAACACCGATTCTTTCAGGTACACGAGGATGCTGGTTTCTACGAGTGTCAAAAGCGGACAATATCTATGCCATCGAATGCCATCGATCGTCGAGGTTTTCGGAGGTTTTCGCACGGACTACGTTATAAAGCCCACTTTTCAGCCATTACAATGTAATCTTCATCGGATCGTGCTCC

Full Affymetrix probeset data:

Annotations for 1626684_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720