FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626685_at:

>probe:Drosophila_2:1626685_at:383:329; Interrogation_Position=410; Antisense; GCGTGGGCGAGGTCAAACCCTTGAA
>probe:Drosophila_2:1626685_at:621:199; Interrogation_Position=425; Antisense; AACCCTTGAAGGATGATCGCGTCGA
>probe:Drosophila_2:1626685_at:722:449; Interrogation_Position=439; Antisense; GATCGCGTCGAGGTTACTACTGAGA
>probe:Drosophila_2:1626685_at:438:385; Interrogation_Position=487; Antisense; GAACAGCAATCGCAGGACATGCAAC
>probe:Drosophila_2:1626685_at:282:77; Interrogation_Position=527; Antisense; AGGATGCAGCTGAGGACCAGGATCA
>probe:Drosophila_2:1626685_at:557:647; Interrogation_Position=549; Antisense; TCAGGAGCAGGACCAAGACCACCAG
>probe:Drosophila_2:1626685_at:468:213; Interrogation_Position=563; Antisense; AAGACCACCAGTCCGTGCAGTCAAA
>probe:Drosophila_2:1626685_at:181:531; Interrogation_Position=597; Antisense; GGGTCAGCAGAACAATCGCCGACGT
>probe:Drosophila_2:1626685_at:287:375; Interrogation_Position=693; Antisense; GAAGTTGCAGCAGCGACGACGCAAT
>probe:Drosophila_2:1626685_at:722:357; Interrogation_Position=731; Antisense; GCAACAACAGTTTGCGTCGTCGTCG
>probe:Drosophila_2:1626685_at:633:185; Interrogation_Position=775; Antisense; AACAACCTGAAACGCCAGCAGCAGA
>probe:Drosophila_2:1626685_at:141:115; Interrogation_Position=794; Antisense; AGCAGAGACGTCGTCGCCCTGGCAA
>probe:Drosophila_2:1626685_at:374:317; Interrogation_Position=920; Antisense; GCCGTCGCCGTCCAAACAGAAATAT
>probe:Drosophila_2:1626685_at:75:635; Interrogation_Position=972; Antisense; TCGCCTTCACGACGACAACATCTGA

Paste this into a BLAST search page for me
GCGTGGGCGAGGTCAAACCCTTGAAAACCCTTGAAGGATGATCGCGTCGAGATCGCGTCGAGGTTACTACTGAGAGAACAGCAATCGCAGGACATGCAACAGGATGCAGCTGAGGACCAGGATCATCAGGAGCAGGACCAAGACCACCAGAAGACCACCAGTCCGTGCAGTCAAAGGGTCAGCAGAACAATCGCCGACGTGAAGTTGCAGCAGCGACGACGCAATGCAACAACAGTTTGCGTCGTCGTCGAACAACCTGAAACGCCAGCAGCAGAAGCAGAGACGTCGTCGCCCTGGCAAGCCGTCGCCGTCCAAACAGAAATATTCGCCTTCACGACGACAACATCTGA

Full Affymetrix probeset data:

Annotations for 1626685_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720