FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626687_at:

>probe:Drosophila_2:1626687_at:35:311; Interrogation_Position=503; Antisense; GCCAAGGACTTCTCGTAAATGCCAT
>probe:Drosophila_2:1626687_at:532:149; Interrogation_Position=553; Antisense; ACATTCAATCCGGAGGCCACATATC
>probe:Drosophila_2:1626687_at:185:675; Interrogation_Position=574; Antisense; TATCCCCGGGAGTTTCGAGTAAATG
>probe:Drosophila_2:1626687_at:587:417; Interrogation_Position=606; Antisense; GAGCGTTATGATACCCATGATGCAC
>probe:Drosophila_2:1626687_at:100:477; Interrogation_Position=642; Antisense; GTTTGCATTTGGCATCCTAGGGAAT
>probe:Drosophila_2:1626687_at:579:675; Interrogation_Position=659; Antisense; TAGGGAATCTTAAAGCCACCGCCGT
>probe:Drosophila_2:1626687_at:722:591; Interrogation_Position=686; Antisense; TGGTGCCTTTTTCCCATGGAGATCT
>probe:Drosophila_2:1626687_at:311:551; Interrogation_Position=703; Antisense; GGAGATCTCCGAATGCTCTTGATAA
>probe:Drosophila_2:1626687_at:481:441; Interrogation_Position=742; Antisense; GATGGACTTGCTGCCTTGCAAATGA
>probe:Drosophila_2:1626687_at:8:711; Interrogation_Position=787; Antisense; TTAAGCGTTGCCAGGAACCTCACTA
>probe:Drosophila_2:1626687_at:431:675; Interrogation_Position=860; Antisense; TAGAACTCTCTCCAGCTTTTGAAAA
>probe:Drosophila_2:1626687_at:18:205; Interrogation_Position=907; Antisense; AAGCCCAGCAAGTCATTTTCAACGT
>probe:Drosophila_2:1626687_at:556:363; Interrogation_Position=942; Antisense; GAATACCAACTTTCGGATTGACGGA
>probe:Drosophila_2:1626687_at:97:551; Interrogation_Position=964; Antisense; GGAGTTATTCATGTAGTCACCTTTG

Paste this into a BLAST search page for me
GCCAAGGACTTCTCGTAAATGCCATACATTCAATCCGGAGGCCACATATCTATCCCCGGGAGTTTCGAGTAAATGGAGCGTTATGATACCCATGATGCACGTTTGCATTTGGCATCCTAGGGAATTAGGGAATCTTAAAGCCACCGCCGTTGGTGCCTTTTTCCCATGGAGATCTGGAGATCTCCGAATGCTCTTGATAAGATGGACTTGCTGCCTTGCAAATGATTAAGCGTTGCCAGGAACCTCACTATAGAACTCTCTCCAGCTTTTGAAAAAAGCCCAGCAAGTCATTTTCAACGTGAATACCAACTTTCGGATTGACGGAGGAGTTATTCATGTAGTCACCTTTG

Full Affymetrix probeset data:

Annotations for 1626687_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720