Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626688_at:

>probe:Drosophila_2:1626688_at:676:121; Interrogation_Position=375; Antisense; AGCGTGATCATCTGCGGTTATGTCA
>probe:Drosophila_2:1626688_at:290:133; Interrogation_Position=403; Antisense; ACCGCATGGGCGTCTGCATTTGGGC
>probe:Drosophila_2:1626688_at:103:67; Interrogation_Position=463; Antisense; ATGGAGCCATGCCACATATCAACTC
>probe:Drosophila_2:1626688_at:120:21; Interrogation_Position=478; Antisense; ATATCAACTCCCAGAACGATGTGCT
>probe:Drosophila_2:1626688_at:233:443; Interrogation_Position=495; Antisense; GATGTGCTGCGCATTGTCGACTCAC
>probe:Drosophila_2:1626688_at:480:145; Interrogation_Position=514; Antisense; ACTCACTGCCGCCAAGTTACGAAAG
>probe:Drosophila_2:1626688_at:673:121; Interrogation_Position=537; Antisense; AGCGTGGTCAAGTTCGAGCTACCGC
>probe:Drosophila_2:1626688_at:60:673; Interrogation_Position=570; Antisense; TACGAATGCCTGGTCATCAGCTGGG
>probe:Drosophila_2:1626688_at:163:213; Interrogation_Position=755; Antisense; AAGAGATTTTTTCCCAACTGGCAGC
>probe:Drosophila_2:1626688_at:681:195; Interrogation_Position=770; Antisense; AACTGGCAGCGCAACGGATTTCTGT
>probe:Drosophila_2:1626688_at:598:543; Interrogation_Position=785; Antisense; GGATTTCTGTACTTGACCCACTTAA
>probe:Drosophila_2:1626688_at:433:511; Interrogation_Position=872; Antisense; GTGTTTTCGAAAGTTCCCAGAGCAT
>probe:Drosophila_2:1626688_at:534:419; Interrogation_Position=891; Antisense; GAGCATTTAGCTGAATACCGCCATA
>probe:Drosophila_2:1626688_at:126:673; Interrogation_Position=906; Antisense; TACCGCCATATATCCGTATGTCTTA

Paste this into a BLAST search page for me
AGCGTGATCATCTGCGGTTATGTCAACCGCATGGGCGTCTGCATTTGGGCATGGAGCCATGCCACATATCAACTCATATCAACTCCCAGAACGATGTGCTGATGTGCTGCGCATTGTCGACTCACACTCACTGCCGCCAAGTTACGAAAGAGCGTGGTCAAGTTCGAGCTACCGCTACGAATGCCTGGTCATCAGCTGGGAAGAGATTTTTTCCCAACTGGCAGCAACTGGCAGCGCAACGGATTTCTGTGGATTTCTGTACTTGACCCACTTAAGTGTTTTCGAAAGTTCCCAGAGCATGAGCATTTAGCTGAATACCGCCATATACCGCCATATATCCGTATGTCTTA

Full Affymetrix probeset data:

Annotations for 1626688_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime