Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626689_at:

>probe:Drosophila_2:1626689_at:125:651; Interrogation_Position=1158; Antisense; TCACCGGATTGGTTTACCTGCGACA
>probe:Drosophila_2:1626689_at:240:435; Interrogation_Position=1193; Antisense; GAGGTCTTGAGACTTTATCCGCCCA
>probe:Drosophila_2:1626689_at:234:117; Interrogation_Position=1219; Antisense; AGCTTTCCTGGACCGATGCTGCAAT
>probe:Drosophila_2:1626689_at:683:431; Interrogation_Position=1233; Antisense; GATGCTGCAATTCCCGAACGGGCTA
>probe:Drosophila_2:1626689_at:475:339; Interrogation_Position=1254; Antisense; GCTATGATCTCTCGCCGTGGAACGG
>probe:Drosophila_2:1626689_at:679:559; Interrogation_Position=1272; Antisense; GGAACGGTGGATCGCCATTCAAATT
>probe:Drosophila_2:1626689_at:617:133; Interrogation_Position=1307; Antisense; ACGCCTGTCTACATATCGGTGTTGG
>probe:Drosophila_2:1626689_at:126:49; Interrogation_Position=1334; Antisense; ATCCATCGTGATGCACAGTACTGGC
>probe:Drosophila_2:1626689_at:443:89; Interrogation_Position=1350; Antisense; AGTACTGGCCAAATCCCGAAGTCTT
>probe:Drosophila_2:1626689_at:605:163; Interrogation_Position=1490; Antisense; AAAGTTGGACTGCTGCACATCCTAA
>probe:Drosophila_2:1626689_at:184:313; Interrogation_Position=1504; Antisense; GCACATCCTAAATCACTTTCGGGTT
>probe:Drosophila_2:1626689_at:378:105; Interrogation_Position=1552; Antisense; AGAAATGCGGTTCGATCCCAAGGCC
>probe:Drosophila_2:1626689_at:364:669; Interrogation_Position=1581; Antisense; TACTCACTGCTCACAATGGGACCTA
>probe:Drosophila_2:1626689_at:226:593; Interrogation_Position=1597; Antisense; TGGGACCTATCTACGTTTTGTTAAG

Paste this into a BLAST search page for me
TCACCGGATTGGTTTACCTGCGACAGAGGTCTTGAGACTTTATCCGCCCAAGCTTTCCTGGACCGATGCTGCAATGATGCTGCAATTCCCGAACGGGCTAGCTATGATCTCTCGCCGTGGAACGGGGAACGGTGGATCGCCATTCAAATTACGCCTGTCTACATATCGGTGTTGGATCCATCGTGATGCACAGTACTGGCAGTACTGGCCAAATCCCGAAGTCTTAAAGTTGGACTGCTGCACATCCTAAGCACATCCTAAATCACTTTCGGGTTAGAAATGCGGTTCGATCCCAAGGCCTACTCACTGCTCACAATGGGACCTATGGGACCTATCTACGTTTTGTTAAG

Full Affymetrix probeset data:

Annotations for 1626689_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime