FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626692_at:

>probe:Drosophila_2:1626692_at:494:355; Interrogation_Position=16; Antisense; GCACGTTACCAGTTTTTCAGTTCGC
>probe:Drosophila_2:1626692_at:209:671; Interrogation_Position=208; Antisense; TACGGACCTCCCGAGGATGTGGATA
>probe:Drosophila_2:1626692_at:447:63; Interrogation_Position=224; Antisense; ATGTGGATACAGATGCCTTGCCTTC
>probe:Drosophila_2:1626692_at:395:707; Interrogation_Position=241; Antisense; TTGCCTTCGGAACAGGATCCACCAG
>probe:Drosophila_2:1626692_at:609:543; Interrogation_Position=255; Antisense; GGATCCACCAGTGGACACCTTCGAG
>probe:Drosophila_2:1626692_at:399:533; Interrogation_Position=300; Antisense; GGTGGACACCGAGGAGAGCTCACTT
>probe:Drosophila_2:1626692_at:362:551; Interrogation_Position=312; Antisense; GGAGAGCTCACTTGAGGCCACCACA
>probe:Drosophila_2:1626692_at:656:623; Interrogation_Position=359; Antisense; TGCGCAGCCGCCATAGATTGGGCAA
>probe:Drosophila_2:1626692_at:124:361; Interrogation_Position=380; Antisense; GCAAGTTGCAGCTGGCTAAGCCAAA
>probe:Drosophila_2:1626692_at:228:309; Interrogation_Position=463; Antisense; CCAGTGGCTTCGCTGGTTCCAGTAG
>probe:Drosophila_2:1626692_at:634:541; Interrogation_Position=477; Antisense; GGTTCCAGTAGCTCAGGCTCCAGCA
>probe:Drosophila_2:1626692_at:112:265; Interrogation_Position=514; Antisense; CAGTTTTACTATGTGGGTGCCCAGC
>probe:Drosophila_2:1626692_at:514:113; Interrogation_Position=536; Antisense; AGCAGCCGTATTACCTGGCAGCCTA
>probe:Drosophila_2:1626692_at:254:35; Interrogation_Position=61; Antisense; ATCAGCGCGGTGAATTGTGCGGCAC

Paste this into a BLAST search page for me
GCACGTTACCAGTTTTTCAGTTCGCTACGGACCTCCCGAGGATGTGGATAATGTGGATACAGATGCCTTGCCTTCTTGCCTTCGGAACAGGATCCACCAGGGATCCACCAGTGGACACCTTCGAGGGTGGACACCGAGGAGAGCTCACTTGGAGAGCTCACTTGAGGCCACCACATGCGCAGCCGCCATAGATTGGGCAAGCAAGTTGCAGCTGGCTAAGCCAAACCAGTGGCTTCGCTGGTTCCAGTAGGGTTCCAGTAGCTCAGGCTCCAGCACAGTTTTACTATGTGGGTGCCCAGCAGCAGCCGTATTACCTGGCAGCCTAATCAGCGCGGTGAATTGTGCGGCAC

Full Affymetrix probeset data:

Annotations for 1626692_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720