Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626693_at:

>probe:Drosophila_2:1626693_at:70:627; Interrogation_Position=15; Antisense; TCCTTTTCTTTTCGAATTTCTCGTG
>probe:Drosophila_2:1626693_at:250:363; Interrogation_Position=28; Antisense; GAATTTCTCGTGGAAAACGCCAACA
>probe:Drosophila_2:1626693_at:643:693; Interrogation_Position=31; Antisense; TTTCTCGTGGAAAACGCCAACATGG
>probe:Drosophila_2:1626693_at:114:147; Interrogation_Position=42; Antisense; AAACGCCAACATGGGTTTCGCTACT
>probe:Drosophila_2:1626693_at:114:255; Interrogation_Position=48; Antisense; CAACATGGGTTTCGCTACTCTCTGG
>probe:Drosophila_2:1626693_at:55:151; Interrogation_Position=50; Antisense; ACATGGGTTTCGCTACTCTCTGGTA
>probe:Drosophila_2:1626693_at:607:63; Interrogation_Position=52; Antisense; ATGGGTTTCGCTACTCTCTGGTACT
>probe:Drosophila_2:1626693_at:669:691; Interrogation_Position=57; Antisense; TTTCGCTACTCTCTGGTACTCGCAT
>probe:Drosophila_2:1626693_at:661:589; Interrogation_Position=70; Antisense; TGGTACTCGCATCCCCGCAAATATG
>probe:Drosophila_2:1626693_at:575:635; Interrogation_Position=76; Antisense; TCGCATCCCCGCAAATATGGCCAAG
>probe:Drosophila_2:1626693_at:126:45; Interrogation_Position=80; Antisense; ATCCCCGCAAATATGGCCAAGGCTC
>probe:Drosophila_2:1626693_at:551:357; Interrogation_Position=86; Antisense; GCAAATATGGCCAAGGCTCCCGATG
>probe:Drosophila_2:1626693_at:616:163; Interrogation_Position=88; Antisense; AAATATGGCCAAGGCTCCCGATGCT
>probe:Drosophila_2:1626693_at:511:69; Interrogation_Position=92; Antisense; ATGGCCAAGGCTCCCGATGCTGCCG

Paste this into a BLAST search page for me
TCCTTTTCTTTTCGAATTTCTCGTGGAATTTCTCGTGGAAAACGCCAACATTTCTCGTGGAAAACGCCAACATGGAAACGCCAACATGGGTTTCGCTACTCAACATGGGTTTCGCTACTCTCTGGACATGGGTTTCGCTACTCTCTGGTAATGGGTTTCGCTACTCTCTGGTACTTTTCGCTACTCTCTGGTACTCGCATTGGTACTCGCATCCCCGCAAATATGTCGCATCCCCGCAAATATGGCCAAGATCCCCGCAAATATGGCCAAGGCTCGCAAATATGGCCAAGGCTCCCGATGAAATATGGCCAAGGCTCCCGATGCTATGGCCAAGGCTCCCGATGCTGCCG

Full Affymetrix probeset data:

Annotations for 1626693_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime