Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626694_at:

>probe:Drosophila_2:1626694_at:340:239; Interrogation_Position=2071; Antisense; AATACAAATGTATAAGTCTCCCAAT
>probe:Drosophila_2:1626694_at:561:497; Interrogation_Position=2086; Antisense; GTCTCCCAATTCATCTTCTTTAATA
>probe:Drosophila_2:1626694_at:329:599; Interrogation_Position=2228; Antisense; TAGAACTTCCAAAAGACTCTTTTCA
>probe:Drosophila_2:1626694_at:702:209; Interrogation_Position=2240; Antisense; AAGACTCTTTTCAATCTAACGAAAG
>probe:Drosophila_2:1626694_at:220:199; Interrogation_Position=2257; Antisense; AACGAAAGTCAATCATCATGGCAGA
>probe:Drosophila_2:1626694_at:165:269; Interrogation_Position=2273; Antisense; CATGGCAGACTGAACCTCATATTGG
>probe:Drosophila_2:1626694_at:709:377; Interrogation_Position=2284; Antisense; GAACCTCATATTGGGAGAGCAGATG
>probe:Drosophila_2:1626694_at:356:425; Interrogation_Position=2298; Antisense; GAGAGCAGATGACAGCAATCCTAGC
>probe:Drosophila_2:1626694_at:598:399; Interrogation_Position=2308; Antisense; GACAGCAATCCTAGCTTTAATAATT
>probe:Drosophila_2:1626694_at:278:21; Interrogation_Position=2333; Antisense; ATATATTTGGAGAGAGGCTGACATC
>probe:Drosophila_2:1626694_at:724:571; Interrogation_Position=2348; Antisense; GGCTGACATCTAACTTTGCTTTCGA
>probe:Drosophila_2:1626694_at:705:191; Interrogation_Position=2359; Antisense; AACTTTGCTTTCGATGTGCAGAATC
>probe:Drosophila_2:1626694_at:485:509; Interrogation_Position=2374; Antisense; GTGCAGAATCGATTACATTCCCTCG
>probe:Drosophila_2:1626694_at:57:367; Interrogation_Position=2379; Antisense; GAATCGATTACATTCCCTCGAAAAT

Paste this into a BLAST search page for me
AATACAAATGTATAAGTCTCCCAATGTCTCCCAATTCATCTTCTTTAATATAGAACTTCCAAAAGACTCTTTTCAAAGACTCTTTTCAATCTAACGAAAGAACGAAAGTCAATCATCATGGCAGACATGGCAGACTGAACCTCATATTGGGAACCTCATATTGGGAGAGCAGATGGAGAGCAGATGACAGCAATCCTAGCGACAGCAATCCTAGCTTTAATAATTATATATTTGGAGAGAGGCTGACATCGGCTGACATCTAACTTTGCTTTCGAAACTTTGCTTTCGATGTGCAGAATCGTGCAGAATCGATTACATTCCCTCGGAATCGATTACATTCCCTCGAAAAT

Full Affymetrix probeset data:

Annotations for 1626694_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime