Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626695_at:

>probe:Drosophila_2:1626695_at:90:487; Interrogation_Position=3114; Antisense; GTAGTTCATTATCATTCGATGGCCA
>probe:Drosophila_2:1626695_at:321:637; Interrogation_Position=3129; Antisense; TCGATGGCCATCTTGTAATGCTCAT
>probe:Drosophila_2:1626695_at:140:391; Interrogation_Position=3169; Antisense; GAAACCAGAAGTTCTTAGCAGCTAA
>probe:Drosophila_2:1626695_at:304:339; Interrogation_Position=3189; Antisense; GCTAAAACTGGTTGCTTCTTCCTTG
>probe:Drosophila_2:1626695_at:26:469; Interrogation_Position=3199; Antisense; GTTGCTTCTTCCTTGTGAAGCCATT
>probe:Drosophila_2:1626695_at:588:13; Interrogation_Position=3267; Antisense; ATTATGTCGTCTGTCTTTGATCTAG
>probe:Drosophila_2:1626695_at:632:485; Interrogation_Position=3354; Antisense; GTAAATATCTGCTTGTATCATGAAT
>probe:Drosophila_2:1626695_at:579:183; Interrogation_Position=3387; Antisense; AAAAGTCTATGTGCAACCAGGCGGA
>probe:Drosophila_2:1626695_at:621:357; Interrogation_Position=3399; Antisense; GCAACCAGGCGGAGTTTCGTAACCT
>probe:Drosophila_2:1626695_at:212:497; Interrogation_Position=3414; Antisense; TTCGTAACCTCGTACTTCCCATTGA
>probe:Drosophila_2:1626695_at:616:719; Interrogation_Position=3429; Antisense; TTCCCATTGAATCTCATCGCATGAC
>probe:Drosophila_2:1626695_at:457:43; Interrogation_Position=3444; Antisense; ATCGCATGACGTCCTCAAAAACTGT
>probe:Drosophila_2:1626695_at:452:195; Interrogation_Position=3463; Antisense; AACTGTACACAACGATCCATTGCTA
>probe:Drosophila_2:1626695_at:170:449; Interrogation_Position=3476; Antisense; GATCCATTGCTAGAAGGAATCCAGA

Paste this into a BLAST search page for me
GTAGTTCATTATCATTCGATGGCCATCGATGGCCATCTTGTAATGCTCATGAAACCAGAAGTTCTTAGCAGCTAAGCTAAAACTGGTTGCTTCTTCCTTGGTTGCTTCTTCCTTGTGAAGCCATTATTATGTCGTCTGTCTTTGATCTAGGTAAATATCTGCTTGTATCATGAATAAAAGTCTATGTGCAACCAGGCGGAGCAACCAGGCGGAGTTTCGTAACCTTTCGTAACCTCGTACTTCCCATTGATTCCCATTGAATCTCATCGCATGACATCGCATGACGTCCTCAAAAACTGTAACTGTACACAACGATCCATTGCTAGATCCATTGCTAGAAGGAATCCAGA

Full Affymetrix probeset data:

Annotations for 1626695_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime