FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626698_at:

>probe:Drosophila_2:1626698_at:501:609; Interrogation_Position=451; Antisense; TGAGCCGTCCAGATTGCTGCAGGAA
>probe:Drosophila_2:1626698_at:636:515; Interrogation_Position=492; Antisense; GTGTCTACAAACGTTCGCAGGCAGT
>probe:Drosophila_2:1626698_at:84:269; Interrogation_Position=509; Antisense; CAGGCAGTGGGCAATCTCATCGAGA
>probe:Drosophila_2:1626698_at:116:439; Interrogation_Position=608; Antisense; GAGGAACTCTTCGAGGGCTTCACTG
>probe:Drosophila_2:1626698_at:528:481; Interrogation_Position=650; Antisense; GTATTCCTACAAATCGACGAGCGTC
>probe:Drosophila_2:1626698_at:381:417; Interrogation_Position=668; Antisense; GAGCGTCTGGCTCGCATGAGAATCC
>probe:Drosophila_2:1626698_at:252:111; Interrogation_Position=686; Antisense; AGAATCCTGCTCAATAGCTACTCGC
>probe:Drosophila_2:1626698_at:117:139; Interrogation_Position=726; Antisense; ACGTCAGTTTTGTGGACCGCCAGAT
>probe:Drosophila_2:1626698_at:113:305; Interrogation_Position=745; Antisense; CCAGATGGCCCAGTTCCGGAAAAGT
>probe:Drosophila_2:1626698_at:380:547; Interrogation_Position=820; Antisense; GGATGCGTCACCTTGTTTCGAGCAG
>probe:Drosophila_2:1626698_at:26:221; Interrogation_Position=848; Antisense; AAGTGCGGGATCATCTCGGAGCTCA
>probe:Drosophila_2:1626698_at:120:615; Interrogation_Position=926; Antisense; TGAATTTGATTCCAGCCACTCTGCA
>probe:Drosophila_2:1626698_at:72:187; Interrogation_Position=963; Antisense; AACAATGTGTTCTTGGAGTCCTTTC
>probe:Drosophila_2:1626698_at:464:503; Interrogation_Position=980; Antisense; GTCCTTTCTGTGATTACTCTCGTTA

Paste this into a BLAST search page for me
TGAGCCGTCCAGATTGCTGCAGGAAGTGTCTACAAACGTTCGCAGGCAGTCAGGCAGTGGGCAATCTCATCGAGAGAGGAACTCTTCGAGGGCTTCACTGGTATTCCTACAAATCGACGAGCGTCGAGCGTCTGGCTCGCATGAGAATCCAGAATCCTGCTCAATAGCTACTCGCACGTCAGTTTTGTGGACCGCCAGATCCAGATGGCCCAGTTCCGGAAAAGTGGATGCGTCACCTTGTTTCGAGCAGAAGTGCGGGATCATCTCGGAGCTCATGAATTTGATTCCAGCCACTCTGCAAACAATGTGTTCTTGGAGTCCTTTCGTCCTTTCTGTGATTACTCTCGTTA

Full Affymetrix probeset data:

Annotations for 1626698_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720