Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626700_at:

>probe:Drosophila_2:1626700_at:336:97; Interrogation_Position=1073; Antisense; AGATCATTGCGCCACCCGAGAGGAA
>probe:Drosophila_2:1626700_at:534:289; Interrogation_Position=1191; Antisense; CGGAATCGTTCACCGCAAATGCTTT
>probe:Drosophila_2:1626700_at:125:257; Interrogation_Position=1206; Antisense; CAAATGCTTTTAAGTCTTTCGCCCG
>probe:Drosophila_2:1626700_at:252:173; Interrogation_Position=1236; Antisense; AAAGCTCTTCAAAGGCAGCAACCAG
>probe:Drosophila_2:1626700_at:212:131; Interrogation_Position=1296; Antisense; ACCTCGGCTCGGACAGTGATAGACA
>probe:Drosophila_2:1626700_at:388:381; Interrogation_Position=1329; Antisense; GAACCCATCGCACAACAATTATCAT
>probe:Drosophila_2:1626700_at:425:35; Interrogation_Position=1349; Antisense; ATCATCCAACTCAGATTCACAGCAG
>probe:Drosophila_2:1626700_at:649:239; Interrogation_Position=1376; Antisense; AATCAGAGGCAACCTCCGGTTGTCG
>probe:Drosophila_2:1626700_at:61:543; Interrogation_Position=1393; Antisense; GGTTGTCGGTGCTCATCCTTCATGG
>probe:Drosophila_2:1626700_at:115:49; Interrogation_Position=1407; Antisense; ATCCTTCATGGCCATTTCATCGGCA
>probe:Drosophila_2:1626700_at:272:647; Interrogation_Position=1423; Antisense; TCATCGGCAGCGGTATAGCGGATTT
>probe:Drosophila_2:1626700_at:313:43; Interrogation_Position=1464; Antisense; ATCGTAAGAGTCGTGGCTGTGCTCC
>probe:Drosophila_2:1626700_at:603:573; Interrogation_Position=1478; Antisense; GGCTGTGCTCCATGTCGAGTAGCAA
>probe:Drosophila_2:1626700_at:366:417; Interrogation_Position=1518; Antisense; GAGCTTTTAACCCTAGTCAGTGAAT

Paste this into a BLAST search page for me
AGATCATTGCGCCACCCGAGAGGAACGGAATCGTTCACCGCAAATGCTTTCAAATGCTTTTAAGTCTTTCGCCCGAAAGCTCTTCAAAGGCAGCAACCAGACCTCGGCTCGGACAGTGATAGACAGAACCCATCGCACAACAATTATCATATCATCCAACTCAGATTCACAGCAGAATCAGAGGCAACCTCCGGTTGTCGGGTTGTCGGTGCTCATCCTTCATGGATCCTTCATGGCCATTTCATCGGCATCATCGGCAGCGGTATAGCGGATTTATCGTAAGAGTCGTGGCTGTGCTCCGGCTGTGCTCCATGTCGAGTAGCAAGAGCTTTTAACCCTAGTCAGTGAAT

Full Affymetrix probeset data:

Annotations for 1626700_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime