FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626701_at:

>probe:Drosophila_2:1626701_at:567:201; Interrogation_Position=1029; Antisense; AACCGATGACAACCACCGTTTGAAG
>probe:Drosophila_2:1626701_at:52:617; Interrogation_Position=519; Antisense; TGCAAATTCTACTGCGTGCCTATCG
>probe:Drosophila_2:1626701_at:207:507; Interrogation_Position=534; Antisense; GTGCCTATCGCACTGAGGGATTGAA
>probe:Drosophila_2:1626701_at:566:459; Interrogation_Position=576; Antisense; GATTTGGTTCCACTATCATGCGGGA
>probe:Drosophila_2:1626701_at:65:331; Interrogation_Position=595; Antisense; GCGGGAGATTCCATTTAGTCTGATA
>probe:Drosophila_2:1626701_at:488:679; Interrogation_Position=610; Antisense; TAGTCTGATACAGTTTCCGCTCTGG
>probe:Drosophila_2:1626701_at:568:697; Interrogation_Position=641; Antisense; TTTAAGCTGCAATGGACTCCCCTGA
>probe:Drosophila_2:1626701_at:188:531; Interrogation_Position=716; Antisense; GGAGGCATTTCAGCGGGATTAACTA
>probe:Drosophila_2:1626701_at:277:193; Interrogation_Position=736; Antisense; AACTACGCCGCTCGATGTGGTCAAA
>probe:Drosophila_2:1626701_at:683:205; Interrogation_Position=781; Antisense; AAGGGAGAGTCTCAACCGACGTCGC
>probe:Drosophila_2:1626701_at:122:693; Interrogation_Position=820; Antisense; TTTGCATGGCATTTACCTGGAGCGA
>probe:Drosophila_2:1626701_at:342:121; Interrogation_Position=840; Antisense; AGCGAGGCTTCAGCGGTCTGTTTGC
>probe:Drosophila_2:1626701_at:472:519; Interrogation_Position=886; Antisense; GTGGATCACACTGGGCGGTGCATTC
>probe:Drosophila_2:1626701_at:504:509; Interrogation_Position=903; Antisense; GTGCATTCTTCTTTGGCTTCTACGA

Paste this into a BLAST search page for me
AACCGATGACAACCACCGTTTGAAGTGCAAATTCTACTGCGTGCCTATCGGTGCCTATCGCACTGAGGGATTGAAGATTTGGTTCCACTATCATGCGGGAGCGGGAGATTCCATTTAGTCTGATATAGTCTGATACAGTTTCCGCTCTGGTTTAAGCTGCAATGGACTCCCCTGAGGAGGCATTTCAGCGGGATTAACTAAACTACGCCGCTCGATGTGGTCAAAAAGGGAGAGTCTCAACCGACGTCGCTTTGCATGGCATTTACCTGGAGCGAAGCGAGGCTTCAGCGGTCTGTTTGCGTGGATCACACTGGGCGGTGCATTCGTGCATTCTTCTTTGGCTTCTACGA

Full Affymetrix probeset data:

Annotations for 1626701_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720