FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626702_at:

>probe:Drosophila_2:1626702_at:156:581; Interrogation_Position=1675; Antisense; TGGCCAGCGTTGGTCCGGATCTTCT
>probe:Drosophila_2:1626702_at:653:631; Interrogation_Position=1688; Antisense; TCCGGATCTTCTTCCAGCTGGTGGG
>probe:Drosophila_2:1626702_at:373:717; Interrogation_Position=1729; Antisense; TTGTGGGTGTGGTCGCGCAAAACCT
>probe:Drosophila_2:1626702_at:615:117; Interrogation_Position=1759; Antisense; AGCTACAGAAATCGGCTGGGTGCCA
>probe:Drosophila_2:1626702_at:76:137; Interrogation_Position=1855; Antisense; ACGAGTGGGAAATCCATGCTGCCCA
>probe:Drosophila_2:1626702_at:35:565; Interrogation_Position=1885; Antisense; GGAATCACTCCTCTATATGCTGGTA
>probe:Drosophila_2:1626702_at:532:477; Interrogation_Position=1913; Antisense; GTTTTCACAATGTGCCCGTCTACAA
>probe:Drosophila_2:1626702_at:442:163; Interrogation_Position=1993; Antisense; AAATCTCGAACTCTACTATTGTACA
>probe:Drosophila_2:1626702_at:95:609; Interrogation_Position=2048; Antisense; TGAGCCGCGGTGAGAGAACATGATC
>probe:Drosophila_2:1626702_at:385:385; Interrogation_Position=2063; Antisense; GAACATGATCGAACATACGCCTAGT
>probe:Drosophila_2:1626702_at:511:241; Interrogation_Position=2122; Antisense; AATAGCTTTATAGATCGCGCTCCCC
>probe:Drosophila_2:1626702_at:704:481; Interrogation_Position=2150; Antisense; GTACCCATCACCTCCAGTTTTTATT
>probe:Drosophila_2:1626702_at:637:677; Interrogation_Position=2174; Antisense; TAGTAGTTCTCTAGCTAGTCCTAAG
>probe:Drosophila_2:1626702_at:75:677; Interrogation_Position=2185; Antisense; TAGCTAGTCCTAAGCCTGTAAATAG

Paste this into a BLAST search page for me
TGGCCAGCGTTGGTCCGGATCTTCTTCCGGATCTTCTTCCAGCTGGTGGGTTGTGGGTGTGGTCGCGCAAAACCTAGCTACAGAAATCGGCTGGGTGCCAACGAGTGGGAAATCCATGCTGCCCAGGAATCACTCCTCTATATGCTGGTAGTTTTCACAATGTGCCCGTCTACAAAAATCTCGAACTCTACTATTGTACATGAGCCGCGGTGAGAGAACATGATCGAACATGATCGAACATACGCCTAGTAATAGCTTTATAGATCGCGCTCCCCGTACCCATCACCTCCAGTTTTTATTTAGTAGTTCTCTAGCTAGTCCTAAGTAGCTAGTCCTAAGCCTGTAAATAG

Full Affymetrix probeset data:

Annotations for 1626702_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720