Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626704_at:

>probe:Drosophila_2:1626704_at:368:187; Interrogation_Position=2025; Antisense; AACACCAAGTACTCCGGGCTCAGAA
>probe:Drosophila_2:1626704_at:695:523; Interrogation_Position=2040; Antisense; GGGCTCAGAACCAGATCCATGTGAT
>probe:Drosophila_2:1626704_at:649:557; Interrogation_Position=2077; Antisense; GGAAAACTAGTTCCCTATCCGGATG
>probe:Drosophila_2:1626704_at:163:675; Interrogation_Position=2092; Antisense; TATCCGGATGACTGCTCCAAGTTTA
>probe:Drosophila_2:1626704_at:684:161; Interrogation_Position=2118; Antisense; ACAATGTATTCAACCCGATCCTATC
>probe:Drosophila_2:1626704_at:288:449; Interrogation_Position=2134; Antisense; GATCCTATCGTTTATGACTGTCGCG
>probe:Drosophila_2:1626704_at:144:267; Interrogation_Position=2164; Antisense; CAGGAATTTAGTGCCGCCTTGGAAA
>probe:Drosophila_2:1626704_at:456:679; Interrogation_Position=2193; Antisense; TATGGCTCCTTGGTTTGCAAACTGT
>probe:Drosophila_2:1626704_at:50:493; Interrogation_Position=2245; Antisense; GTAACTATTCCTACTACCACAACAA
>probe:Drosophila_2:1626704_at:151:265; Interrogation_Position=2273; Antisense; CAGAGAAGCCTTCACCGAATGGAAT
>probe:Drosophila_2:1626704_at:5:507; Interrogation_Position=2326; Antisense; GTGCCCTATCCTGGGAACTGTAGCA
>probe:Drosophila_2:1626704_at:514:489; Interrogation_Position=2352; Antisense; GTACATTGCTTGTGAAGACCCCATT
>probe:Drosophila_2:1626704_at:110:697; Interrogation_Position=2410; Antisense; TTTAATCCCATCATTCTTACCTGTA
>probe:Drosophila_2:1626704_at:246:509; Interrogation_Position=2465; Antisense; GTGCTTTGCACATTTCACCGAAAAC

Paste this into a BLAST search page for me
AACACCAAGTACTCCGGGCTCAGAAGGGCTCAGAACCAGATCCATGTGATGGAAAACTAGTTCCCTATCCGGATGTATCCGGATGACTGCTCCAAGTTTAACAATGTATTCAACCCGATCCTATCGATCCTATCGTTTATGACTGTCGCGCAGGAATTTAGTGCCGCCTTGGAAATATGGCTCCTTGGTTTGCAAACTGTGTAACTATTCCTACTACCACAACAACAGAGAAGCCTTCACCGAATGGAATGTGCCCTATCCTGGGAACTGTAGCAGTACATTGCTTGTGAAGACCCCATTTTTAATCCCATCATTCTTACCTGTAGTGCTTTGCACATTTCACCGAAAAC

Full Affymetrix probeset data:

Annotations for 1626704_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime