FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626706_at:

>probe:Drosophila_2:1626706_at:291:21; Interrogation_Position=2061; Antisense; ATATACATTGAACCGGAGGCCGTTG
>probe:Drosophila_2:1626706_at:173:173; Interrogation_Position=2094; Antisense; AAAGACTAACCGCTCTCAAAGAGGA
>probe:Drosophila_2:1626706_at:255:685; Interrogation_Position=2187; Antisense; TATACATAGCGAAAACCACCCACAC
>probe:Drosophila_2:1626706_at:240:421; Interrogation_Position=2219; Antisense; GAGCACAAACCTTCCAACAAATCGT
>probe:Drosophila_2:1626706_at:704:635; Interrogation_Position=2240; Antisense; TCGTTAACCCACAATCACACTATAT
>probe:Drosophila_2:1626706_at:316:31; Interrogation_Position=2268; Antisense; ATAAGGAATCGCTTTAATCGCCGCC
>probe:Drosophila_2:1626706_at:513:581; Interrogation_Position=2299; Antisense; TGGCCTCATACTCCCACAATATGCA
>probe:Drosophila_2:1626706_at:664:161; Interrogation_Position=2314; Antisense; ACAATATGCACACTCCAATCCGTAT
>probe:Drosophila_2:1626706_at:633:235; Interrogation_Position=2330; Antisense; AATCCGTATCATTTTTTATCGAAAG
>probe:Drosophila_2:1626706_at:42:395; Interrogation_Position=2370; Antisense; GAAATGTCCACTGTCTAATATTAAT
>probe:Drosophila_2:1626706_at:258:23; Interrogation_Position=2434; Antisense; ATATCATAGTTTAGTGCAGGCAGAG
>probe:Drosophila_2:1626706_at:355:431; Interrogation_Position=2458; Antisense; GATGTGTGTACCAGAAAGTTCCCTC
>probe:Drosophila_2:1626706_at:257:391; Interrogation_Position=2471; Antisense; GAAAGTTCCCTCTGATTTGCAATTA
>probe:Drosophila_2:1626706_at:601:283; Interrogation_Position=2482; Antisense; CTGATTTGCAATTAACCCACTGTAA

Paste this into a BLAST search page for me
ATATACATTGAACCGGAGGCCGTTGAAAGACTAACCGCTCTCAAAGAGGATATACATAGCGAAAACCACCCACACGAGCACAAACCTTCCAACAAATCGTTCGTTAACCCACAATCACACTATATATAAGGAATCGCTTTAATCGCCGCCTGGCCTCATACTCCCACAATATGCAACAATATGCACACTCCAATCCGTATAATCCGTATCATTTTTTATCGAAAGGAAATGTCCACTGTCTAATATTAATATATCATAGTTTAGTGCAGGCAGAGGATGTGTGTACCAGAAAGTTCCCTCGAAAGTTCCCTCTGATTTGCAATTACTGATTTGCAATTAACCCACTGTAA

Full Affymetrix probeset data:

Annotations for 1626706_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720