Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626707_a_at:

>probe:Drosophila_2:1626707_a_at:255:99; Interrogation_Position=678; Antisense; AGATGAGTCCACCTTCAACTCGATC
>probe:Drosophila_2:1626707_a_at:684:299; Interrogation_Position=730; Antisense; CGCCAGATCTTCCTCGAATACGAGA
>probe:Drosophila_2:1626707_a_at:409:27; Interrogation_Position=747; Antisense; ATACGAGAATCTGTCGGGCAACGAC
>probe:Drosophila_2:1626707_a_at:113:421; Interrogation_Position=775; Antisense; GAGAAGGCCATCAAGCGGGAGTTTA
>probe:Drosophila_2:1626707_a_at:185:653; Interrogation_Position=785; Antisense; TCAAGCGGGAGTTTAGCGGCTCCGT
>probe:Drosophila_2:1626707_a_at:184:581; Interrogation_Position=824; Antisense; TGGCCATCGTCAAGTGCTGCAAGTC
>probe:Drosophila_2:1626707_a_at:55:87; Interrogation_Position=836; Antisense; AGTGCTGCAAGTCCAAGATCGACTA
>probe:Drosophila_2:1626707_a_at:490:97; Interrogation_Position=851; Antisense; AGATCGACTACTTTTCGGAGCGCCT
>probe:Drosophila_2:1626707_a_at:427:611; Interrogation_Position=875; Antisense; TGCACGACTCAATGGCCGGCATGGG
>probe:Drosophila_2:1626707_a_at:642:73; Interrogation_Position=905; Antisense; AGGACAAGACGCTGATCCGCATCAT
>probe:Drosophila_2:1626707_a_at:730:605; Interrogation_Position=917; Antisense; TGATCCGCATCATTGTCAGCCGGTC
>probe:Drosophila_2:1626707_a_at:467:727; Interrogation_Position=929; Antisense; TTGTCAGCCGGTCGGAGATCGATCT
>probe:Drosophila_2:1626707_a_at:124:437; Interrogation_Position=967; Antisense; GAGGCATTCCAGAACAAGTACGGCA
>probe:Drosophila_2:1626707_a_at:351:361; Interrogation_Position=989; Antisense; GCAAGAGCTTGGAGTCCTGGATCAA

Paste this into a BLAST search page for me
AGATGAGTCCACCTTCAACTCGATCCGCCAGATCTTCCTCGAATACGAGAATACGAGAATCTGTCGGGCAACGACGAGAAGGCCATCAAGCGGGAGTTTATCAAGCGGGAGTTTAGCGGCTCCGTTGGCCATCGTCAAGTGCTGCAAGTCAGTGCTGCAAGTCCAAGATCGACTAAGATCGACTACTTTTCGGAGCGCCTTGCACGACTCAATGGCCGGCATGGGAGGACAAGACGCTGATCCGCATCATTGATCCGCATCATTGTCAGCCGGTCTTGTCAGCCGGTCGGAGATCGATCTGAGGCATTCCAGAACAAGTACGGCAGCAAGAGCTTGGAGTCCTGGATCAA

Full Affymetrix probeset data:

Annotations for 1626707_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime