Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626708_at:

>probe:Drosophila_2:1626708_at:689:505; Interrogation_Position=2169; Antisense; GTGCGTTCGTTTAGTTGTTCGTTCT
>probe:Drosophila_2:1626708_at:632:135; Interrogation_Position=2203; Antisense; ACGCTCTCTCTATCTATTGATCACG
>probe:Drosophila_2:1626708_at:637:33; Interrogation_Position=2222; Antisense; ATCACGTTCGCCTCTGTTTATGAAT
>probe:Drosophila_2:1626708_at:186:709; Interrogation_Position=2253; Antisense; TTAATCGATTCGATTCGCCCTCGAT
>probe:Drosophila_2:1626708_at:450:321; Interrogation_Position=2269; Antisense; GCCCTCGATTGCACTTTTGTACATA
>probe:Drosophila_2:1626708_at:333:615; Interrogation_Position=2338; Antisense; TGAATTTTCTCTTTCACATCCAGCT
>probe:Drosophila_2:1626708_at:212:153; Interrogation_Position=2353; Antisense; ACATCCAGCTTGATTATCCCTTGAT
>probe:Drosophila_2:1626708_at:31:47; Interrogation_Position=2368; Antisense; ATCCCTTGATTATGTATGCCGCAGT
>probe:Drosophila_2:1626708_at:350:319; Interrogation_Position=2385; Antisense; GCCGCAGTATTTTTGTATCTATCCC
>probe:Drosophila_2:1626708_at:671:277; Interrogation_Position=2403; Antisense; CTATCCCTACTCTAGAATCATTCTC
>probe:Drosophila_2:1626708_at:125:709; Interrogation_Position=2501; Antisense; TTGTAGTAGCGTGCGTTTACTTCCC
>probe:Drosophila_2:1626708_at:382:699; Interrogation_Position=2541; Antisense; TTTTATTTGTAAGCAGCCAACGCGC
>probe:Drosophila_2:1626708_at:233:201; Interrogation_Position=2559; Antisense; AACGCGCTGCCCTAAGACTGTAATT
>probe:Drosophila_2:1626708_at:124:549; Interrogation_Position=2637; Antisense; GGAGGCCTCGAATCGATCGATAATT

Paste this into a BLAST search page for me
GTGCGTTCGTTTAGTTGTTCGTTCTACGCTCTCTCTATCTATTGATCACGATCACGTTCGCCTCTGTTTATGAATTTAATCGATTCGATTCGCCCTCGATGCCCTCGATTGCACTTTTGTACATATGAATTTTCTCTTTCACATCCAGCTACATCCAGCTTGATTATCCCTTGATATCCCTTGATTATGTATGCCGCAGTGCCGCAGTATTTTTGTATCTATCCCCTATCCCTACTCTAGAATCATTCTCTTGTAGTAGCGTGCGTTTACTTCCCTTTTATTTGTAAGCAGCCAACGCGCAACGCGCTGCCCTAAGACTGTAATTGGAGGCCTCGAATCGATCGATAATT

Full Affymetrix probeset data:

Annotations for 1626708_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime