FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626709_at:

>probe:Drosophila_2:1626709_at:47:221; Interrogation_Position=158; Antisense; AAGTGCTTCAACTGCGCCAGGTGCA
>probe:Drosophila_2:1626709_at:435:423; Interrogation_Position=17; Antisense; GAGAACTTGGCATCCGAACGACCCT
>probe:Drosophila_2:1626709_at:308:621; Interrogation_Position=201; Antisense; TGCTCGCCTGTGACGGACCGGATGA
>probe:Drosophila_2:1626709_at:221:689; Interrogation_Position=233; Antisense; TATTGCAAGCTCTGCTACGCGAAGC
>probe:Drosophila_2:1626709_at:399:287; Interrogation_Position=299; Antisense; CTGGTGTCCACCAACTACGAGTACA
>probe:Drosophila_2:1626709_at:684:381; Interrogation_Position=32; Antisense; GAACGACCCTTTGTGGCTCCGGACA
>probe:Drosophila_2:1626709_at:437:543; Interrogation_Position=389; Antisense; GGATTCATGGTCTTCGCCGCGGAAC
>probe:Drosophila_2:1626709_at:120:161; Interrogation_Position=441; Antisense; ACAAGCTCTGTTTCTACTGCATGGA
>probe:Drosophila_2:1626709_at:417:85; Interrogation_Position=465; Antisense; AGTGCCGGAAATACCTGGACTCGAC
>probe:Drosophila_2:1626709_at:553:413; Interrogation_Position=487; Antisense; GACCAATCTGAACGACGGACCCGAT
>probe:Drosophila_2:1626709_at:345:37; Interrogation_Position=518; Antisense; ATCTATTGCCGATCGTGCTACGCCA
>probe:Drosophila_2:1626709_at:404:339; Interrogation_Position=534; Antisense; GCTACGCCAAGTTCTATGGGCCAAA
>probe:Drosophila_2:1626709_at:708:237; Interrogation_Position=574; Antisense; AATCGGAGCTGGCACACTGACAATG
>probe:Drosophila_2:1626709_at:67:713; Interrogation_Position=61; Antisense; TTCGATCATGGCTCCGGACGGCGAG

Paste this into a BLAST search page for me
AAGTGCTTCAACTGCGCCAGGTGCAGAGAACTTGGCATCCGAACGACCCTTGCTCGCCTGTGACGGACCGGATGATATTGCAAGCTCTGCTACGCGAAGCCTGGTGTCCACCAACTACGAGTACAGAACGACCCTTTGTGGCTCCGGACAGGATTCATGGTCTTCGCCGCGGAACACAAGCTCTGTTTCTACTGCATGGAAGTGCCGGAAATACCTGGACTCGACGACCAATCTGAACGACGGACCCGATATCTATTGCCGATCGTGCTACGCCAGCTACGCCAAGTTCTATGGGCCAAAAATCGGAGCTGGCACACTGACAATGTTCGATCATGGCTCCGGACGGCGAG

Full Affymetrix probeset data:

Annotations for 1626709_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720