FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626710_at:

>probe:Drosophila_2:1626710_at:656:469; Interrogation_Position=3044; Antisense; GTTCGCAAGAGTTTGTGGACCTCAA
>probe:Drosophila_2:1626710_at:282:95; Interrogation_Position=3071; Antisense; AGTTGGCCAAGCGATTTGCGCTCAC
>probe:Drosophila_2:1626710_at:649:721; Interrogation_Position=3086; Antisense; TTGCGCTCACATTTGGTTTCGATGC
>probe:Drosophila_2:1626710_at:471:49; Interrogation_Position=3107; Antisense; ATGCCATCAAGAATCGCGAATCTGT
>probe:Drosophila_2:1626710_at:433:291; Interrogation_Position=3145; Antisense; CGTGGTGGCATTTATTTCGCTGCGA
>probe:Drosophila_2:1626710_at:661:693; Interrogation_Position=3159; Antisense; TTTCGCTGCGAACAAGGAGCCAGAT
>probe:Drosophila_2:1626710_at:381:99; Interrogation_Position=3180; Antisense; AGATGATCCGGTGCGGGCTCCAACT
>probe:Drosophila_2:1626710_at:563:325; Interrogation_Position=3206; Antisense; GCTTGCTCTTCCTGGAGGTTTTGAA
>probe:Drosophila_2:1626710_at:499:559; Interrogation_Position=3285; Antisense; GGACAAGATAATACCACCCGCAATG
>probe:Drosophila_2:1626710_at:406:67; Interrogation_Position=3330; Antisense; ATGGCAGCCGCTGATATTATATCGC
>probe:Drosophila_2:1626710_at:444:297; Interrogation_Position=3352; Antisense; CGCAATTCCTTGCTACATGGCGAAA
>probe:Drosophila_2:1626710_at:709:133; Interrogation_Position=3402; Antisense; ACGAGCCTACACACGTAAACGTCGA
>probe:Drosophila_2:1626710_at:120:523; Interrogation_Position=3489; Antisense; GGGCTAGGACCCATCAGGCAATCAG
>probe:Drosophila_2:1626710_at:193:239; Interrogation_Position=3508; Antisense; AATCAGCCATACACGCGGCTTAAGT

Paste this into a BLAST search page for me
GTTCGCAAGAGTTTGTGGACCTCAAAGTTGGCCAAGCGATTTGCGCTCACTTGCGCTCACATTTGGTTTCGATGCATGCCATCAAGAATCGCGAATCTGTCGTGGTGGCATTTATTTCGCTGCGATTTCGCTGCGAACAAGGAGCCAGATAGATGATCCGGTGCGGGCTCCAACTGCTTGCTCTTCCTGGAGGTTTTGAAGGACAAGATAATACCACCCGCAATGATGGCAGCCGCTGATATTATATCGCCGCAATTCCTTGCTACATGGCGAAAACGAGCCTACACACGTAAACGTCGAGGGCTAGGACCCATCAGGCAATCAGAATCAGCCATACACGCGGCTTAAGT

Full Affymetrix probeset data:

Annotations for 1626710_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720