FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626713_at:

>probe:Drosophila_2:1626713_at:371:185; Interrogation_Position=401; Antisense; AAAATTCAATTGACTTCCACCTTGT
>probe:Drosophila_2:1626713_at:575:129; Interrogation_Position=419; Antisense; ACCTTGTCCGCATTTCTACGAATTA
>probe:Drosophila_2:1626713_at:59:363; Interrogation_Position=438; Antisense; GAATTAGTGGGTTTGTTCTGGCCGT
>probe:Drosophila_2:1626713_at:714:689; Interrogation_Position=468; Antisense; TTTGGTTCGTGGGAATCAGCGGCCT
>probe:Drosophila_2:1626713_at:214:367; Interrogation_Position=480; Antisense; GAATCAGCGGCCTTTGCTTGCAAGG
>probe:Drosophila_2:1626713_at:449:389; Interrogation_Position=533; Antisense; GAAAAATGTGACTGCCACGGCATGG
>probe:Drosophila_2:1626713_at:137:607; Interrogation_Position=573; Antisense; TGATGGTGACCATGCCATTTGCCTA
>probe:Drosophila_2:1626713_at:412:693; Interrogation_Position=590; Antisense; TTTGCCTACCATACAGTCGCCGGAA
>probe:Drosophila_2:1626713_at:185:299; Interrogation_Position=607; Antisense; CGCCGGAACTCGACATTTGATCTGG
>probe:Drosophila_2:1626713_at:113:457; Interrogation_Position=652; Antisense; GATACCAGAGATCTATGCCACCGGC
>probe:Drosophila_2:1626713_at:457:63; Interrogation_Position=678; Antisense; ATGTGGCTGTGGCTCTAACCATTGC
>probe:Drosophila_2:1626713_at:457:659; Interrogation_Position=693; Antisense; TAACCATTGCTCTGTCTGCCTTTTT
>probe:Drosophila_2:1626713_at:186:325; Interrogation_Position=815; Antisense; GCGAAGAAAGATGCTCCCAAGGATA
>probe:Drosophila_2:1626713_at:323:565; Interrogation_Position=890; Antisense; GGCAAGTCTGCCAAATGATCAAATA

Paste this into a BLAST search page for me
AAAATTCAATTGACTTCCACCTTGTACCTTGTCCGCATTTCTACGAATTAGAATTAGTGGGTTTGTTCTGGCCGTTTTGGTTCGTGGGAATCAGCGGCCTGAATCAGCGGCCTTTGCTTGCAAGGGAAAAATGTGACTGCCACGGCATGGTGATGGTGACCATGCCATTTGCCTATTTGCCTACCATACAGTCGCCGGAACGCCGGAACTCGACATTTGATCTGGGATACCAGAGATCTATGCCACCGGCATGTGGCTGTGGCTCTAACCATTGCTAACCATTGCTCTGTCTGCCTTTTTGCGAAGAAAGATGCTCCCAAGGATAGGCAAGTCTGCCAAATGATCAAATA

Full Affymetrix probeset data:

Annotations for 1626713_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720