Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626715_at:

>probe:Drosophila_2:1626715_at:229:105; Interrogation_Position=215; Antisense; AGACTTGTGCCAACATCTACCTGAA
>probe:Drosophila_2:1626715_at:65:235; Interrogation_Position=271; Antisense; AATGCCACCAATGCTTGCGAGGAGG
>probe:Drosophila_2:1626715_at:428:77; Interrogation_Position=290; Antisense; AGGAGGCAGCCAATCGCACCAATGT
>probe:Drosophila_2:1626715_at:50:203; Interrogation_Position=346; Antisense; AACCAGATCCGTCTCCAGTTGTTGA
>probe:Drosophila_2:1626715_at:708:119; Interrogation_Position=389; Antisense; AGCTGTGCCGCAACGAGACCGATTC
>probe:Drosophila_2:1626715_at:484:103; Interrogation_Position=404; Antisense; AGACCGATTCGGCTATTTTCCTGAA
>probe:Drosophila_2:1626715_at:695:15; Interrogation_Position=418; Antisense; ATTTTCCTGAACTGCACTGTGTCCA
>probe:Drosophila_2:1626715_at:143:695; Interrogation_Position=444; Antisense; TTTCGACAAGAACCTCCAGCTGCTG
>probe:Drosophila_2:1626715_at:207:717; Interrogation_Position=508; Antisense; TTCGTTTCCAATGCCACTCAGATGA
>probe:Drosophila_2:1626715_at:22:107; Interrogation_Position=539; Antisense; AGAAATCGAACTGCATCAGCTCCGC
>probe:Drosophila_2:1626715_at:551:265; Interrogation_Position=592; Antisense; CAGGCGGCCAACGACTTTAATTCGT
>probe:Drosophila_2:1626715_at:362:377; Interrogation_Position=690; Antisense; GAAGCCCACCCAGATAACCAAAGAG
>probe:Drosophila_2:1626715_at:715:219; Interrogation_Position=716; Antisense; AAGTGTCTGCGAAGCCACAGCTGAT
>probe:Drosophila_2:1626715_at:98:297; Interrogation_Position=744; Antisense; CGAAGATCTGCCTTTGACCAACTAA

Paste this into a BLAST search page for me
AGACTTGTGCCAACATCTACCTGAAAATGCCACCAATGCTTGCGAGGAGGAGGAGGCAGCCAATCGCACCAATGTAACCAGATCCGTCTCCAGTTGTTGAAGCTGTGCCGCAACGAGACCGATTCAGACCGATTCGGCTATTTTCCTGAAATTTTCCTGAACTGCACTGTGTCCATTTCGACAAGAACCTCCAGCTGCTGTTCGTTTCCAATGCCACTCAGATGAAGAAATCGAACTGCATCAGCTCCGCCAGGCGGCCAACGACTTTAATTCGTGAAGCCCACCCAGATAACCAAAGAGAAGTGTCTGCGAAGCCACAGCTGATCGAAGATCTGCCTTTGACCAACTAA

Full Affymetrix probeset data:

Annotations for 1626715_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime