FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626717_at:

>probe:Drosophila_2:1626717_at:533:257; Interrogation_Position=106; Antisense; CACACGCGTCTTGTGGAGTGCGGAT
>probe:Drosophila_2:1626717_at:128:623; Interrogation_Position=124; Antisense; TGCGGATGGCACAAGGACATTAAGG
>probe:Drosophila_2:1626717_at:699:271; Interrogation_Position=162; Antisense; CATCATCATGGAGCGCGGAGTGGAC
>probe:Drosophila_2:1626717_at:485:243; Interrogation_Position=187; Antisense; AATATAAACCGCGACCAACTGGCTG
>probe:Drosophila_2:1626717_at:488:195; Interrogation_Position=203; Antisense; AACTGGCTGCCCAAATAGTCCCGCA
>probe:Drosophila_2:1626717_at:420:163; Interrogation_Position=215; Antisense; AAATAGTCCCGCAAGCTCGCGCTTT
>probe:Drosophila_2:1626717_at:517:205; Interrogation_Position=227; Antisense; AAGCTCGCGCTTTGGTGCCTGAAGT
>probe:Drosophila_2:1626717_at:396:341; Interrogation_Position=235; Antisense; GCTTTGGTGCCTGAAGTCGTCAAAA
>probe:Drosophila_2:1626717_at:204:57; Interrogation_Position=260; Antisense; ATGAGATGATGCTGCGCGTGCACGC
>probe:Drosophila_2:1626717_at:458:449; Interrogation_Position=40; Antisense; GATCCCGATCCTGGATATAAGCCTA
>probe:Drosophila_2:1626717_at:122:543; Interrogation_Position=52; Antisense; GGATATAAGCCTACGTTACGCAGTC
>probe:Drosophila_2:1626717_at:711:671; Interrogation_Position=68; Antisense; TACGCAGTCAAGATAAGGCCGCCCT
>probe:Drosophila_2:1626717_at:369:453; Interrogation_Position=79; Antisense; GATAAGGCCGCCCTGAAGGAACTGC
>probe:Drosophila_2:1626717_at:163:225; Interrogation_Position=94; Antisense; AAGGAACTGCTGCACACGCGTCTTG

Paste this into a BLAST search page for me
CACACGCGTCTTGTGGAGTGCGGATTGCGGATGGCACAAGGACATTAAGGCATCATCATGGAGCGCGGAGTGGACAATATAAACCGCGACCAACTGGCTGAACTGGCTGCCCAAATAGTCCCGCAAAATAGTCCCGCAAGCTCGCGCTTTAAGCTCGCGCTTTGGTGCCTGAAGTGCTTTGGTGCCTGAAGTCGTCAAAAATGAGATGATGCTGCGCGTGCACGCGATCCCGATCCTGGATATAAGCCTAGGATATAAGCCTACGTTACGCAGTCTACGCAGTCAAGATAAGGCCGCCCTGATAAGGCCGCCCTGAAGGAACTGCAAGGAACTGCTGCACACGCGTCTTG

Full Affymetrix probeset data:

Annotations for 1626717_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720