FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626718_at:

>probe:Drosophila_2:1626718_at:526:383; Interrogation_Position=277; Antisense; GAACTGCGCACCTTCAACGGAGATG
>probe:Drosophila_2:1626718_at:182:551; Interrogation_Position=295; Antisense; GGAGATGCCGTAGGAACACCCGTTT
>probe:Drosophila_2:1626718_at:417:561; Interrogation_Position=307; Antisense; GGAACACCCGTTTACGCTGGAATCA
>probe:Drosophila_2:1626718_at:555:331; Interrogation_Position=322; Antisense; GCTGGAATCATCAACCGGTCGAACG
>probe:Drosophila_2:1626718_at:198:281; Interrogation_Position=381; Antisense; CTCAACGCATCGGTCTTTCAATGGA
>probe:Drosophila_2:1626718_at:230:613; Interrogation_Position=417; Antisense; TGACAATATAGCCTTGCTCCACGTC
>probe:Drosophila_2:1626718_at:35:629; Interrogation_Position=434; Antisense; TCCACGTCTCTGAGAGCTTCGAGTA
>probe:Drosophila_2:1626718_at:404:429; Interrogation_Position=454; Antisense; GAGTACAACGCTCGAGTTCAGCAGA
>probe:Drosophila_2:1626718_at:91:173; Interrogation_Position=571; Antisense; AAAGAGTTGCAGTATGCCTTCGCTC
>probe:Drosophila_2:1626718_at:377:469; Interrogation_Position=614; Antisense; GTTGCAAGGAGTTGCTGCCCGCAGA
>probe:Drosophila_2:1626718_at:72:323; Interrogation_Position=652; Antisense; GCGCAGCAGGTGTGCTCTCAGGTAA
>probe:Drosophila_2:1626718_at:363:595; Interrogation_Position=743; Antisense; TGGGCCTCGGATCCTGGAGCTATAT
>probe:Drosophila_2:1626718_at:77:25; Interrogation_Position=764; Antisense; ATATGCCGTGCGGATATGCCAATCG
>probe:Drosophila_2:1626718_at:191:49; Interrogation_Position=779; Antisense; ATGCCAATCGGCCAACGGTGTACAC

Paste this into a BLAST search page for me
GAACTGCGCACCTTCAACGGAGATGGGAGATGCCGTAGGAACACCCGTTTGGAACACCCGTTTACGCTGGAATCAGCTGGAATCATCAACCGGTCGAACGCTCAACGCATCGGTCTTTCAATGGATGACAATATAGCCTTGCTCCACGTCTCCACGTCTCTGAGAGCTTCGAGTAGAGTACAACGCTCGAGTTCAGCAGAAAAGAGTTGCAGTATGCCTTCGCTCGTTGCAAGGAGTTGCTGCCCGCAGAGCGCAGCAGGTGTGCTCTCAGGTAATGGGCCTCGGATCCTGGAGCTATATATATGCCGTGCGGATATGCCAATCGATGCCAATCGGCCAACGGTGTACAC

Full Affymetrix probeset data:

Annotations for 1626718_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720