FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626720_at:

>probe:Drosophila_2:1626720_at:684:245; Interrogation_Position=223; Antisense; AATTCCATAAAGTCACTGCCAGTCA
>probe:Drosophila_2:1626720_at:143:283; Interrogation_Position=238; Antisense; CTGCCAGTCAAATTTCCATCAACAC
>probe:Drosophila_2:1626720_at:205:223; Interrogation_Position=306; Antisense; AAGGTGTTTACAATGCGCAGCTCCC
>probe:Drosophila_2:1626720_at:443:115; Interrogation_Position=324; Antisense; AGCTCCCAAGTGCAAAACATCTTCC
>probe:Drosophila_2:1626720_at:286:33; Interrogation_Position=342; Antisense; ATCTTCCAGAAGTTCCATTCAGTCG
>probe:Drosophila_2:1626720_at:626:161; Interrogation_Position=419; Antisense; AAATTCCTATCATTCGACGCAAGCC
>probe:Drosophila_2:1626720_at:538:487; Interrogation_Position=477; Antisense; GTACCGAAGGCTTCACAACGCCAAT
>probe:Drosophila_2:1626720_at:223:389; Interrogation_Position=517; Antisense; GAAAAACTTTGTTCCTATGCACAGG
>probe:Drosophila_2:1626720_at:265:581; Interrogation_Position=575; Antisense; TGGAAACTCGACCTAATCCTCTTTA
>probe:Drosophila_2:1626720_at:494:413; Interrogation_Position=584; Antisense; GACCTAATCCTCTTTACGGCGAGAA
>probe:Drosophila_2:1626720_at:143:21; Interrogation_Position=608; Antisense; ATATTATGCGTGTCCGGAGATCCAA
>probe:Drosophila_2:1626720_at:135:279; Interrogation_Position=681; Antisense; CTACGATTACTTAAAGCCAGGCTTT
>probe:Drosophila_2:1626720_at:44:383; Interrogation_Position=719; Antisense; GACATTTTACCCAGTTGGTTTGGAG
>probe:Drosophila_2:1626720_at:365:291; Interrogation_Position=768; Antisense; CGTGGCATGCGAGTGGGTTCATAAT

Paste this into a BLAST search page for me
AATTCCATAAAGTCACTGCCAGTCACTGCCAGTCAAATTTCCATCAACACAAGGTGTTTACAATGCGCAGCTCCCAGCTCCCAAGTGCAAAACATCTTCCATCTTCCAGAAGTTCCATTCAGTCGAAATTCCTATCATTCGACGCAAGCCGTACCGAAGGCTTCACAACGCCAATGAAAAACTTTGTTCCTATGCACAGGTGGAAACTCGACCTAATCCTCTTTAGACCTAATCCTCTTTACGGCGAGAAATATTATGCGTGTCCGGAGATCCAACTACGATTACTTAAAGCCAGGCTTTGACATTTTACCCAGTTGGTTTGGAGCGTGGCATGCGAGTGGGTTCATAAT

Full Affymetrix probeset data:

Annotations for 1626720_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720