Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626721_at:

>probe:Drosophila_2:1626721_at:79:555; Interrogation_Position=405; Antisense; GGAGCCCATGGACAAAACTCTGAAT
>probe:Drosophila_2:1626721_at:319:707; Interrogation_Position=528; Antisense; TTACATATGCGAGCTGTGCGGGACT
>probe:Drosophila_2:1626721_at:655:507; Interrogation_Position=543; Antisense; GTGCGGGACTCATGCCACATCGAAA
>probe:Drosophila_2:1626721_at:690:437; Interrogation_Position=599; Antisense; GAGGCGAACGACCATTTGGCTGCAA
>probe:Drosophila_2:1626721_at:169:251; Interrogation_Position=621; Antisense; CAAGGATTGTGATGCCAGGTTTCTC
>probe:Drosophila_2:1626721_at:571:77; Interrogation_Position=637; Antisense; AGGTTTCTCTCTGCTGGCGAACTAC
>probe:Drosophila_2:1626721_at:291:529; Interrogation_Position=686; Antisense; GGGAGCAACCGTTTGCCTGTCGCTT
>probe:Drosophila_2:1626721_at:669:537; Interrogation_Position=722; Antisense; GGTATGTCAGCTACATGGGCCGGCT
>probe:Drosophila_2:1626721_at:574:197; Interrogation_Position=769; Antisense; AACGATCGACCCTATGTGTGCGAAG
>probe:Drosophila_2:1626721_at:386:281; Interrogation_Position=815; Antisense; CTGCCTACGTCCTAAAGAACCACAT
>probe:Drosophila_2:1626721_at:225:563; Interrogation_Position=860; Antisense; GGAATTTCCGATGCGATATTTGCGA
>probe:Drosophila_2:1626721_at:8:721; Interrogation_Position=879; Antisense; TTGCGATCGCTCCTTCCAGAGAAAG
>probe:Drosophila_2:1626721_at:117:107; Interrogation_Position=898; Antisense; AGAAAGGCGCACCTGGTAACGCACA
>probe:Drosophila_2:1626721_at:160:449; Interrogation_Position=926; Antisense; GATCCATGATGCACCTCCAAAATGT

Paste this into a BLAST search page for me
GGAGCCCATGGACAAAACTCTGAATTTACATATGCGAGCTGTGCGGGACTGTGCGGGACTCATGCCACATCGAAAGAGGCGAACGACCATTTGGCTGCAACAAGGATTGTGATGCCAGGTTTCTCAGGTTTCTCTCTGCTGGCGAACTACGGGAGCAACCGTTTGCCTGTCGCTTGGTATGTCAGCTACATGGGCCGGCTAACGATCGACCCTATGTGTGCGAAGCTGCCTACGTCCTAAAGAACCACATGGAATTTCCGATGCGATATTTGCGATTGCGATCGCTCCTTCCAGAGAAAGAGAAAGGCGCACCTGGTAACGCACAGATCCATGATGCACCTCCAAAATGT

Full Affymetrix probeset data:

Annotations for 1626721_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime