FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626722_at:

>probe:Drosophila_2:1626722_at:190:323; Interrogation_Position=1722; Antisense; GCGCCTGCGCGTCGAGATGAATTTT
>probe:Drosophila_2:1626722_at:63:475; Interrogation_Position=1801; Antisense; GTTAATAACCTAAGCAACGCCGTCT
>probe:Drosophila_2:1626722_at:576:447; Interrogation_Position=1845; Antisense; GATCCAAGCGCGGTATGAGGCCTCA
>probe:Drosophila_2:1626722_at:605:161; Interrogation_Position=1871; Antisense; AAATTGCCTGGATTTGGTCCGATGG
>probe:Drosophila_2:1626722_at:388:535; Interrogation_Position=1886; Antisense; GGTCCGATGGCAGTGTCTTGATAAT
>probe:Drosophila_2:1626722_at:341:49; Interrogation_Position=1925; Antisense; ATGCGATGCTGGCAGAAACCCAACG
>probe:Drosophila_2:1626722_at:97:177; Interrogation_Position=1940; Antisense; AAACCCAACGGGATCTATTGCTTAG
>probe:Drosophila_2:1626722_at:267:699; Interrogation_Position=1984; Antisense; TTTAAAGCCGATCCCTCAAACAAGC
>probe:Drosophila_2:1626722_at:622:525; Interrogation_Position=2049; Antisense; GGGCATCTCTTTGCCGGAGTTCATC
>probe:Drosophila_2:1626722_at:397:637; Interrogation_Position=2072; Antisense; TCGAGTCATGCGCTATTTGTCCAGA
>probe:Drosophila_2:1626722_at:209:21; Interrogation_Position=2086; Antisense; ATTTGTCCAGAACCCCATATGAAGT
>probe:Drosophila_2:1626722_at:465:461; Interrogation_Position=2172; Antisense; GATTCAGGTGTTTGCCATGACCACT
>probe:Drosophila_2:1626722_at:238:391; Interrogation_Position=2220; Antisense; GAAAGTGTACCCCATTACGGCCAAT
>probe:Drosophila_2:1626722_at:328:373; Interrogation_Position=2249; Antisense; GAAGGGCCACCATAGATGTCATCAA

Paste this into a BLAST search page for me
GCGCCTGCGCGTCGAGATGAATTTTGTTAATAACCTAAGCAACGCCGTCTGATCCAAGCGCGGTATGAGGCCTCAAAATTGCCTGGATTTGGTCCGATGGGGTCCGATGGCAGTGTCTTGATAATATGCGATGCTGGCAGAAACCCAACGAAACCCAACGGGATCTATTGCTTAGTTTAAAGCCGATCCCTCAAACAAGCGGGCATCTCTTTGCCGGAGTTCATCTCGAGTCATGCGCTATTTGTCCAGAATTTGTCCAGAACCCCATATGAAGTGATTCAGGTGTTTGCCATGACCACTGAAAGTGTACCCCATTACGGCCAATGAAGGGCCACCATAGATGTCATCAA

Full Affymetrix probeset data:

Annotations for 1626722_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720