Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626723_at:

>probe:Drosophila_2:1626723_at:111:599; Interrogation_Position=2079; Antisense; TGTCCTGCCACTGGAACAGATTGTG
>probe:Drosophila_2:1626723_at:256:189; Interrogation_Position=2093; Antisense; AACAGATTGTGAATCCTCCTGGCCT
>probe:Drosophila_2:1626723_at:567:527; Interrogation_Position=2137; Antisense; GGGAAATGCAATTTGCCACTGCTTG
>probe:Drosophila_2:1626723_at:219:285; Interrogation_Position=2155; Antisense; CTGCTTGCTCTACTCTGTACATATA
>probe:Drosophila_2:1626723_at:604:711; Interrogation_Position=2208; Antisense; TTGCATTGCAGGGTGGGTCGATTTA
>probe:Drosophila_2:1626723_at:508:163; Interrogation_Position=2267; Antisense; AAATCGTTAGCCTCTGTGCTTAGTT
>probe:Drosophila_2:1626723_at:467:609; Interrogation_Position=2293; Antisense; TGCAAAGTAGTTTCGTTTCCAATGA
>probe:Drosophila_2:1626723_at:643:293; Interrogation_Position=2338; Antisense; CGAACTTTATCTGTCCGCTATATAC
>probe:Drosophila_2:1626723_at:614:721; Interrogation_Position=2388; Antisense; TTGCACTTCTGTAAATCGAGCCACC
>probe:Drosophila_2:1626723_at:712:43; Interrogation_Position=2402; Antisense; ATCGAGCCACCCGAATGTGAAGTCG
>probe:Drosophila_2:1626723_at:60:501; Interrogation_Position=2423; Antisense; GTCGAAGTCGAATTTCCGGTTGTCA
>probe:Drosophila_2:1626723_at:80:399; Interrogation_Position=2524; Antisense; GACACTTTAACCATCGAAGAGCTGT
>probe:Drosophila_2:1626723_at:396:599; Interrogation_Position=2559; Antisense; TGTTGTAAACATCTAGGCTAAGCCA
>probe:Drosophila_2:1626723_at:715:483; Interrogation_Position=2621; Antisense; GTATCTGCGTATATGTTGTGCTATT

Paste this into a BLAST search page for me
TGTCCTGCCACTGGAACAGATTGTGAACAGATTGTGAATCCTCCTGGCCTGGGAAATGCAATTTGCCACTGCTTGCTGCTTGCTCTACTCTGTACATATATTGCATTGCAGGGTGGGTCGATTTAAAATCGTTAGCCTCTGTGCTTAGTTTGCAAAGTAGTTTCGTTTCCAATGACGAACTTTATCTGTCCGCTATATACTTGCACTTCTGTAAATCGAGCCACCATCGAGCCACCCGAATGTGAAGTCGGTCGAAGTCGAATTTCCGGTTGTCAGACACTTTAACCATCGAAGAGCTGTTGTTGTAAACATCTAGGCTAAGCCAGTATCTGCGTATATGTTGTGCTATT

Full Affymetrix probeset data:

Annotations for 1626723_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime