FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626725_at:

>probe:Drosophila_2:1626725_at:417:305; Interrogation_Position=1046; Antisense; CCTTATCCCACCTGGATGGACAGAA
>probe:Drosophila_2:1626725_at:188:67; Interrogation_Position=1061; Antisense; ATGGACAGAATGCTGCTTCGCTCAC
>probe:Drosophila_2:1626725_at:356:319; Interrogation_Position=1090; Antisense; GCCGAGCAGTACATTGGAGCCTTCA
>probe:Drosophila_2:1626725_at:584:365; Interrogation_Position=1131; Antisense; GAATAACACCATGATCTTGCCCTCG
>probe:Drosophila_2:1626725_at:478:59; Interrogation_Position=1166; Antisense; ATGTTAATGGCTTCGTGGCCCAGGC
>probe:Drosophila_2:1626725_at:38:583; Interrogation_Position=1193; Antisense; TGGCGGTGTACAACCACGTTTCCAA
>probe:Drosophila_2:1626725_at:408:577; Interrogation_Position=1261; Antisense; GGCGCCTGCCTGAACGCAAAGAGTG
>probe:Drosophila_2:1626725_at:169:427; Interrogation_Position=781; Antisense; GAGATCCGTGATATTCGACTGCCCA
>probe:Drosophila_2:1626725_at:527:129; Interrogation_Position=805; Antisense; ACCAGGGTTCACGAGGCGATGCAGA
>probe:Drosophila_2:1626725_at:131:393; Interrogation_Position=851; Antisense; GAAAGCGAGCCGCTATTCTCGAATC
>probe:Drosophila_2:1626725_at:569:77; Interrogation_Position=878; Antisense; AGGGTGTTCGCGAGGCCGAAATCAA
>probe:Drosophila_2:1626725_at:190:213; Interrogation_Position=922; Antisense; AAGTCTAGGATTCTAGCCTCCGAGG
>probe:Drosophila_2:1626725_at:306:331; Interrogation_Position=946; Antisense; GCGGAGCGGCAGGAGCACATCAATA
>probe:Drosophila_2:1626725_at:605:71; Interrogation_Position=983; Antisense; AGGCGGCTGCCATTATAGCCGTGGC

Paste this into a BLAST search page for me
CCTTATCCCACCTGGATGGACAGAAATGGACAGAATGCTGCTTCGCTCACGCCGAGCAGTACATTGGAGCCTTCAGAATAACACCATGATCTTGCCCTCGATGTTAATGGCTTCGTGGCCCAGGCTGGCGGTGTACAACCACGTTTCCAAGGCGCCTGCCTGAACGCAAAGAGTGGAGATCCGTGATATTCGACTGCCCAACCAGGGTTCACGAGGCGATGCAGAGAAAGCGAGCCGCTATTCTCGAATCAGGGTGTTCGCGAGGCCGAAATCAAAAGTCTAGGATTCTAGCCTCCGAGGGCGGAGCGGCAGGAGCACATCAATAAGGCGGCTGCCATTATAGCCGTGGC

Full Affymetrix probeset data:

Annotations for 1626725_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720