Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626727_at:

>probe:Drosophila_2:1626727_at:579:409; Interrogation_Position=2368; Antisense; GACCTGACGGACTCGTATGCGCCGG
>probe:Drosophila_2:1626727_at:641:629; Interrogation_Position=2396; Antisense; TCCTGATGGCCGGACTCATGATCGC
>probe:Drosophila_2:1626727_at:90:649; Interrogation_Position=2411; Antisense; TCATGATCGCCATCAGCGGACTGGT
>probe:Drosophila_2:1626727_at:265:121; Interrogation_Position=2425; Antisense; AGCGGACTGGTGATGTTCGCCATTC
>probe:Drosophila_2:1626727_at:29:125; Interrogation_Position=2459; Antisense; AGCGCCTGCAGGTTCGCAAGTCGGA
>probe:Drosophila_2:1626727_at:518:575; Interrogation_Position=2507; Antisense; TGGCCCTTAGTTAGTAGTTCACCGC
>probe:Drosophila_2:1626727_at:602:305; Interrogation_Position=2555; Antisense; CCTGTTTATTCCTACTCCATATTTT
>probe:Drosophila_2:1626727_at:287:489; Interrogation_Position=2618; Antisense; GTACTGATGCACACGACACTTGGTT
>probe:Drosophila_2:1626727_at:667:679; Interrogation_Position=2660; Antisense; TAGGCCAGCCATGTACCGAGGTATG
>probe:Drosophila_2:1626727_at:550:435; Interrogation_Position=2677; Antisense; GAGGTATGCGTGTATGCCGCAGCTA
>probe:Drosophila_2:1626727_at:115:627; Interrogation_Position=2691; Antisense; TGCCGCAGCTATGGCATATCCGAAT
>probe:Drosophila_2:1626727_at:601:729; Interrogation_Position=2718; Antisense; TTGTGTACGGGCGACTGTCACCGAA
>probe:Drosophila_2:1626727_at:577:689; Interrogation_Position=2893; Antisense; TATTATGACTGTATGCCTGTGCGTG
>probe:Drosophila_2:1626727_at:14:505; Interrogation_Position=2921; Antisense; GTCCGTCTGTGTATGCGCCATTAAA

Paste this into a BLAST search page for me
GACCTGACGGACTCGTATGCGCCGGTCCTGATGGCCGGACTCATGATCGCTCATGATCGCCATCAGCGGACTGGTAGCGGACTGGTGATGTTCGCCATTCAGCGCCTGCAGGTTCGCAAGTCGGATGGCCCTTAGTTAGTAGTTCACCGCCCTGTTTATTCCTACTCCATATTTTGTACTGATGCACACGACACTTGGTTTAGGCCAGCCATGTACCGAGGTATGGAGGTATGCGTGTATGCCGCAGCTATGCCGCAGCTATGGCATATCCGAATTTGTGTACGGGCGACTGTCACCGAATATTATGACTGTATGCCTGTGCGTGGTCCGTCTGTGTATGCGCCATTAAA

Full Affymetrix probeset data:

Annotations for 1626727_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime