FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626728_at:

>probe:Drosophila_2:1626728_at:610:457; Interrogation_Position=127; Antisense; GATTTGGCCAAACTAAACGATCTGT
>probe:Drosophila_2:1626728_at:562:197; Interrogation_Position=142; Antisense; AACGATCTGTGCCTCGGAATTAGCC
>probe:Drosophila_2:1626728_at:175:561; Interrogation_Position=15; Antisense; GGAAACAATTGAGCCAGCGATCTTC
>probe:Drosophila_2:1626728_at:111:565; Interrogation_Position=157; Antisense; GGAATTAGCCGCACTTGCATCGTTC
>probe:Drosophila_2:1626728_at:636:345; Interrogation_Position=173; Antisense; GCATCGTTCTCAGTGCTTTCAAGAA
>probe:Drosophila_2:1626728_at:23:695; Interrogation_Position=189; Antisense; TTTCAAGAAGCTCCACCGTACACGA
>probe:Drosophila_2:1626728_at:660:579; Interrogation_Position=245; Antisense; TGGCGGCGGGACGACTAAAAATCAA
>probe:Drosophila_2:1626728_at:122:367; Interrogation_Position=271; Antisense; GAATCTTTCCTGCAGAATCGTAATG
>probe:Drosophila_2:1626728_at:110:653; Interrogation_Position=326; Antisense; TCAAGCTGGCGCAGGACGTGGATTT
>probe:Drosophila_2:1626728_at:38:291; Interrogation_Position=342; Antisense; CGTGGATTTGGAGCTGCGAACGAAT
>probe:Drosophila_2:1626728_at:660:381; Interrogation_Position=359; Antisense; GAACGAATGTCATCCAAGCCCAGAA
>probe:Drosophila_2:1626728_at:22:335; Interrogation_Position=42; Antisense; GCTTAGTTTAGTGCTTGTCAGTCGA
>probe:Drosophila_2:1626728_at:356:51; Interrogation_Position=84; Antisense; ATGCGCAGCCCCAAGTGGCATTTGT
>probe:Drosophila_2:1626728_at:494:521; Interrogation_Position=98; Antisense; GTGGCATTTGTCACGCTCCAAGCGA

Paste this into a BLAST search page for me
GATTTGGCCAAACTAAACGATCTGTAACGATCTGTGCCTCGGAATTAGCCGGAAACAATTGAGCCAGCGATCTTCGGAATTAGCCGCACTTGCATCGTTCGCATCGTTCTCAGTGCTTTCAAGAATTTCAAGAAGCTCCACCGTACACGATGGCGGCGGGACGACTAAAAATCAAGAATCTTTCCTGCAGAATCGTAATGTCAAGCTGGCGCAGGACGTGGATTTCGTGGATTTGGAGCTGCGAACGAATGAACGAATGTCATCCAAGCCCAGAAGCTTAGTTTAGTGCTTGTCAGTCGAATGCGCAGCCCCAAGTGGCATTTGTGTGGCATTTGTCACGCTCCAAGCGA

Full Affymetrix probeset data:

Annotations for 1626728_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720