FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626729_at:

>probe:Drosophila_2:1626729_at:661:45; Interrogation_Position=1005; Antisense; ATCCGACGACGGTGCAGTTCAATCA
>probe:Drosophila_2:1626729_at:123:35; Interrogation_Position=1026; Antisense; ATCACCGCATCCTTGGTATTAGCAC
>probe:Drosophila_2:1626729_at:536:13; Interrogation_Position=1043; Antisense; ATTAGCACAGTAACGCTGACCACCG
>probe:Drosophila_2:1626729_at:647:371; Interrogation_Position=1086; Antisense; GAAGGATGCAGTTGCCCAAGCGCGC
>probe:Drosophila_2:1626729_at:709:725; Interrogation_Position=1161; Antisense; TTGGCGTAACCACCTTGCTTAACTA
>probe:Drosophila_2:1626729_at:672:635; Interrogation_Position=1223; Antisense; TCGCTTATTCTGCTGAGTTTCGCAT
>probe:Drosophila_2:1626729_at:687:429; Interrogation_Position=1237; Antisense; GAGTTTCGCATTGTGGCTGTCGCAC
>probe:Drosophila_2:1626729_at:399:539; Interrogation_Position=1264; Antisense; GGTTCGACTGTTGAAGTACCTTCCG
>probe:Drosophila_2:1626729_at:510:187; Interrogation_Position=794; Antisense; AACACATTCGTGATCCAAGCCAAGA
>probe:Drosophila_2:1626729_at:72:409; Interrogation_Position=850; Antisense; GACGAAGGCAATGGTCCTGCTGACT
>probe:Drosophila_2:1626729_at:218:405; Interrogation_Position=871; Antisense; GACTGCCATTTCTGGAGCCTTTGTA
>probe:Drosophila_2:1626729_at:257:553; Interrogation_Position=884; Antisense; GGAGCCTTTGTAGCCGGACTAGACG
>probe:Drosophila_2:1626729_at:16:635; Interrogation_Position=915; Antisense; TCGTGTACAACTCGTTCCCGAAGAT
>probe:Drosophila_2:1626729_at:627:55; Interrogation_Position=960; Antisense; ATGACATGTGGACGTTTGCGCCCAT

Paste this into a BLAST search page for me
ATCCGACGACGGTGCAGTTCAATCAATCACCGCATCCTTGGTATTAGCACATTAGCACAGTAACGCTGACCACCGGAAGGATGCAGTTGCCCAAGCGCGCTTGGCGTAACCACCTTGCTTAACTATCGCTTATTCTGCTGAGTTTCGCATGAGTTTCGCATTGTGGCTGTCGCACGGTTCGACTGTTGAAGTACCTTCCGAACACATTCGTGATCCAAGCCAAGAGACGAAGGCAATGGTCCTGCTGACTGACTGCCATTTCTGGAGCCTTTGTAGGAGCCTTTGTAGCCGGACTAGACGTCGTGTACAACTCGTTCCCGAAGATATGACATGTGGACGTTTGCGCCCAT

Full Affymetrix probeset data:

Annotations for 1626729_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720