Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626731_at:

>probe:Drosophila_2:1626731_at:449:659; Interrogation_Position=1262; Antisense; TAAGCAGGTCTTGACGCGAGCCCAC
>probe:Drosophila_2:1626731_at:78:725; Interrogation_Position=1272; Antisense; TTGACGCGAGCCCACGAACGTGAGT
>probe:Drosophila_2:1626731_at:161:383; Interrogation_Position=1287; Antisense; GAACGTGAGTTTGGAGCCATCGACA
>probe:Drosophila_2:1626731_at:448:143; Interrogation_Position=1380; Antisense; ACTCCATATGGCGAGTACGGCGGTT
>probe:Drosophila_2:1626731_at:557:227; Interrogation_Position=1410; Antisense; AAGGCCGCTAAAGTGGATTCGCCCA
>probe:Drosophila_2:1626731_at:390:537; Interrogation_Position=1436; Antisense; GGTCACAACCACTCTAAAAAATCTG
>probe:Drosophila_2:1626731_at:163:161; Interrogation_Position=1454; Antisense; AAATCTGGGAGCACTTTACCGACGT
>probe:Drosophila_2:1626731_at:460:271; Interrogation_Position=1467; Antisense; CTTTACCGACGTCAAGGCATGTTTG
>probe:Drosophila_2:1626731_at:142:691; Interrogation_Position=1488; Antisense; TTTGAAGCGGCCGAAACCCTGGAAG
>probe:Drosophila_2:1626731_at:75:177; Interrogation_Position=1501; Antisense; AAACCCTGGAAGACTGTGCAATGCG
>probe:Drosophila_2:1626731_at:241:107; Interrogation_Position=1535; Antisense; AGAAGCCTACGATCTAGCTAAACAA
>probe:Drosophila_2:1626731_at:675:377; Interrogation_Position=1562; Antisense; GAAGCTCTCACAATTGCTAACGTCA
>probe:Drosophila_2:1626731_at:676:163; Interrogation_Position=1659; Antisense; AAATATTATTTGTTCATCGCCCACA
>probe:Drosophila_2:1626731_at:381:271; Interrogation_Position=1673; Antisense; CATCGCCCACAACGGAATCTTTAAG

Paste this into a BLAST search page for me
TAAGCAGGTCTTGACGCGAGCCCACTTGACGCGAGCCCACGAACGTGAGTGAACGTGAGTTTGGAGCCATCGACAACTCCATATGGCGAGTACGGCGGTTAAGGCCGCTAAAGTGGATTCGCCCAGGTCACAACCACTCTAAAAAATCTGAAATCTGGGAGCACTTTACCGACGTCTTTACCGACGTCAAGGCATGTTTGTTTGAAGCGGCCGAAACCCTGGAAGAAACCCTGGAAGACTGTGCAATGCGAGAAGCCTACGATCTAGCTAAACAAGAAGCTCTCACAATTGCTAACGTCAAAATATTATTTGTTCATCGCCCACACATCGCCCACAACGGAATCTTTAAG

Full Affymetrix probeset data:

Annotations for 1626731_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime