FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626733_at:

>probe:Drosophila_2:1626733_at:528:575; Interrogation_Position=368; Antisense; GGCGATCGCAAATCTCTGGAGTTCA
>probe:Drosophila_2:1626733_at:512:429; Interrogation_Position=386; Antisense; GAGTTCAAGTTGTACCTGCAGCAGG
>probe:Drosophila_2:1626733_at:343:69; Interrogation_Position=408; Antisense; AGGCGCTAAGTGCTGCCATTAAATC
>probe:Drosophila_2:1626733_at:207:81; Interrogation_Position=471; Antisense; AGGTGCTCCAAGACGACGGCGCCAA
>probe:Drosophila_2:1626733_at:214:311; Interrogation_Position=492; Antisense; CCAACTATGCGGTGGCTCTTAATGC
>probe:Drosophila_2:1626733_at:213:447; Interrogation_Position=536; Antisense; GATGCGGGAATCTGCCTCAATGAGT
>probe:Drosophila_2:1626733_at:313:231; Interrogation_Position=554; Antisense; AATGAGTTCATTGTCGCCTGCACCG
>probe:Drosophila_2:1626733_at:614:549; Interrogation_Position=641; Antisense; GGACCGAAACTAACCGTGGCTGCCT
>probe:Drosophila_2:1626733_at:133:609; Interrogation_Position=699; Antisense; TGAGTGAGCGGTTCCACATCGATCA
>probe:Drosophila_2:1626733_at:714:453; Interrogation_Position=719; Antisense; GATCACTTGGAAACCGTCATCGAGA
>probe:Drosophila_2:1626733_at:182:43; Interrogation_Position=737; Antisense; ATCGAGACTGCTATGGCGGGTTGCC
>probe:Drosophila_2:1626733_at:431:225; Interrogation_Position=794; Antisense; AAGGAGCACCTTCTGCACATGGGCA
>probe:Drosophila_2:1626733_at:130:349; Interrogation_Position=816; Antisense; GCAGTGCCTCTGACTTTGCGAAAGT
>probe:Drosophila_2:1626733_at:616:237; Interrogation_Position=856; Antisense; AATCTTTTCTATTCCAATCTTGTCG

Paste this into a BLAST search page for me
GGCGATCGCAAATCTCTGGAGTTCAGAGTTCAAGTTGTACCTGCAGCAGGAGGCGCTAAGTGCTGCCATTAAATCAGGTGCTCCAAGACGACGGCGCCAACCAACTATGCGGTGGCTCTTAATGCGATGCGGGAATCTGCCTCAATGAGTAATGAGTTCATTGTCGCCTGCACCGGGACCGAAACTAACCGTGGCTGCCTTGAGTGAGCGGTTCCACATCGATCAGATCACTTGGAAACCGTCATCGAGAATCGAGACTGCTATGGCGGGTTGCCAAGGAGCACCTTCTGCACATGGGCAGCAGTGCCTCTGACTTTGCGAAAGTAATCTTTTCTATTCCAATCTTGTCG

Full Affymetrix probeset data:

Annotations for 1626733_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720