FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626734_at:

>probe:Drosophila_2:1626734_at:157:231; Interrogation_Position=1106; Antisense; CAATGGACAATTTCGGTTGGTTGCC
>probe:Drosophila_2:1626734_at:493:539; Interrogation_Position=1124; Antisense; GGTTGCCGATCAGCAGTATCTGCAT
>probe:Drosophila_2:1626734_at:646:283; Interrogation_Position=1143; Antisense; CTGCATTTTCATAATCTTCTTCTCG
>probe:Drosophila_2:1626734_at:387:711; Interrogation_Position=1162; Antisense; TTCTCGATTGGATTCGGACCGGTGC
>probe:Drosophila_2:1626734_at:7:607; Interrogation_Position=1196; Antisense; TGATGGCGGAACTCTTCTCGGAGGA
>probe:Drosophila_2:1626734_at:21:113; Interrogation_Position=1255; Antisense; AGCAACTGGCTGTCGGCCTTCGTGG
>probe:Drosophila_2:1626734_at:459:235; Interrogation_Position=1296; Antisense; AATCCTCAAGAGCTCGATCGGGCCG
>probe:Drosophila_2:1626734_at:714:197; Interrogation_Position=1325; Antisense; CGACCTTTTGGATCTTTACCGCGAT
>probe:Drosophila_2:1626734_at:658:641; Interrogation_Position=1374; Antisense; TCTGTTCTTCGTGCCGGAGACCAAG
>probe:Drosophila_2:1626734_at:150:233; Interrogation_Position=1416; Antisense; AATCCAGGACCTGCTGTCCGGAGGA
>probe:Drosophila_2:1626734_at:357:415; Interrogation_Position=1464; Antisense; GAGCCAGACGTGATGATGTCGCGTA
>probe:Drosophila_2:1626734_at:213:427; Interrogation_Position=1478; Antisense; GATGTCGCGTAGTCTTAGTCGTAGC
>probe:Drosophila_2:1626734_at:44:325; Interrogation_Position=1501; Antisense; GCGATACTTTTTCATATTCTCCTTA
>probe:Drosophila_2:1626734_at:261:363; Interrogation_Position=1608; Antisense; GAATTTTCGTTCATTTCCGTCAGTG

Paste this into a BLAST search page for me
CAATGGACAATTTCGGTTGGTTGCCGGTTGCCGATCAGCAGTATCTGCATCTGCATTTTCATAATCTTCTTCTCGTTCTCGATTGGATTCGGACCGGTGCTGATGGCGGAACTCTTCTCGGAGGAAGCAACTGGCTGTCGGCCTTCGTGGAATCCTCAAGAGCTCGATCGGGCCGCGACCTTTTGGATCTTTACCGCGATTCTGTTCTTCGTGCCGGAGACCAAGAATCCAGGACCTGCTGTCCGGAGGAGAGCCAGACGTGATGATGTCGCGTAGATGTCGCGTAGTCTTAGTCGTAGCGCGATACTTTTTCATATTCTCCTTAGAATTTTCGTTCATTTCCGTCAGTG

Full Affymetrix probeset data:

Annotations for 1626734_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720