FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626735_at:

>probe:Drosophila_2:1626735_at:58:389; Interrogation_Position=117; Antisense; GAAAAAGTTCAATGCACTCCGTTTT
>probe:Drosophila_2:1626735_at:202:93; Interrogation_Position=122; Antisense; AGTTCAATGCACTCCGTTTTGTTAA
>probe:Drosophila_2:1626735_at:4:655; Interrogation_Position=125; Antisense; TCAATGCACTCCGTTTTGTTAAGGA
>probe:Drosophila_2:1626735_at:405:257; Interrogation_Position=130; Antisense; GCACTCCGTTTTGTTAAGGAGACGG
>probe:Drosophila_2:1626735_at:287:225; Interrogation_Position=145; Antisense; AAGGAGACGGCTTTACAGTTACTCT
>probe:Drosophila_2:1626735_at:475:407; Interrogation_Position=150; Antisense; GACGGCTTTACAGTTACTCTTCGTA
>probe:Drosophila_2:1626735_at:98:571; Interrogation_Position=153; Antisense; GGCTTTACAGTTACTCTTCGTAATG
>probe:Drosophila_2:1626735_at:429:279; Interrogation_Position=166; Antisense; CTCTTCGTAATGGAGTTTTCTCAAT
>probe:Drosophila_2:1626735_at:146:63; Interrogation_Position=175; Antisense; ATGGAGTTTTCTCAATAAATTGTAT
>probe:Drosophila_2:1626735_at:7:249; Interrogation_Position=192; Antisense; AATTGTATTTTCTGCGCTTCTCTTG
>probe:Drosophila_2:1626735_at:654:695; Interrogation_Position=200; Antisense; TTTCTGCGCTTCTCTTGCAGCTAAA
>probe:Drosophila_2:1626735_at:80:343; Interrogation_Position=207; Antisense; GCTTCTCTTGCAGCTAAACTACTCA
>probe:Drosophila_2:1626735_at:208:155; Interrogation_Position=240; Antisense; ACAGAATGTTCGTTGCTGGCCAAGA
>probe:Drosophila_2:1626735_at:454:231; Interrogation_Position=244; Antisense; AATGTTCGTTGCTGGCCAAGATGAG

Paste this into a BLAST search page for me
GAAAAAGTTCAATGCACTCCGTTTTAGTTCAATGCACTCCGTTTTGTTAATCAATGCACTCCGTTTTGTTAAGGAGCACTCCGTTTTGTTAAGGAGACGGAAGGAGACGGCTTTACAGTTACTCTGACGGCTTTACAGTTACTCTTCGTAGGCTTTACAGTTACTCTTCGTAATGCTCTTCGTAATGGAGTTTTCTCAATATGGAGTTTTCTCAATAAATTGTATAATTGTATTTTCTGCGCTTCTCTTGTTTCTGCGCTTCTCTTGCAGCTAAAGCTTCTCTTGCAGCTAAACTACTCAACAGAATGTTCGTTGCTGGCCAAGAAATGTTCGTTGCTGGCCAAGATGAG

Full Affymetrix probeset data:

Annotations for 1626735_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720