FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626736_at:

>probe:Drosophila_2:1626736_at:383:91; Interrogation_Position=4173; Antisense; AGTATCGGACGCTTTGCCAATTCAA
>probe:Drosophila_2:1626736_at:9:247; Interrogation_Position=4191; Antisense; AATTCAAGCGGCTACGCCGGAGGTC
>probe:Drosophila_2:1626736_at:475:79; Interrogation_Position=4211; Antisense; AGGTCCCACCGATTTCGATGCCAGT
>probe:Drosophila_2:1626736_at:89:87; Interrogation_Position=4233; Antisense; AGTGCTGGCGGCTATGTCGACATCT
>probe:Drosophila_2:1626736_at:529:501; Interrogation_Position=4248; Antisense; GTCGACATCTTCACCACTTTCGTTG
>probe:Drosophila_2:1626736_at:78:403; Interrogation_Position=4278; Antisense; GACATTGCCCTTGCCAATTGCAATA
>probe:Drosophila_2:1626736_at:628:247; Interrogation_Position=4293; Antisense; AATTGCAATAGCTCCCACTGTGTCA
>probe:Drosophila_2:1626736_at:549:495; Interrogation_Position=4314; Antisense; GTCACTGCCAGTGGTTTCAGCTGGA
>probe:Drosophila_2:1626736_at:532:517; Interrogation_Position=4339; Antisense; GTGGTTGCGCCGGTCCTAGCAATAC
>probe:Drosophila_2:1626736_at:486:305; Interrogation_Position=4353; Antisense; CCTAGCAATACCATCCTCGAATATA
>probe:Drosophila_2:1626736_at:241:21; Interrogation_Position=4373; Antisense; ATATAAATGGATCCGATCGCCCTCC
>probe:Drosophila_2:1626736_at:3:375; Interrogation_Position=4420; Antisense; GAAGTTAGCAATTTCATCCGAGAAC
>probe:Drosophila_2:1626736_at:160:203; Interrogation_Position=4522; Antisense; AACCATTTGGTTAACGCCATGGGCA
>probe:Drosophila_2:1626736_at:148:503; Interrogation_Position=4600; Antisense; GTCCCGCCAGGCGATGTAAAGGATT

Paste this into a BLAST search page for me
AGTATCGGACGCTTTGCCAATTCAAAATTCAAGCGGCTACGCCGGAGGTCAGGTCCCACCGATTTCGATGCCAGTAGTGCTGGCGGCTATGTCGACATCTGTCGACATCTTCACCACTTTCGTTGGACATTGCCCTTGCCAATTGCAATAAATTGCAATAGCTCCCACTGTGTCAGTCACTGCCAGTGGTTTCAGCTGGAGTGGTTGCGCCGGTCCTAGCAATACCCTAGCAATACCATCCTCGAATATAATATAAATGGATCCGATCGCCCTCCGAAGTTAGCAATTTCATCCGAGAACAACCATTTGGTTAACGCCATGGGCAGTCCCGCCAGGCGATGTAAAGGATT

Full Affymetrix probeset data:

Annotations for 1626736_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720