FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626737_at:

>probe:Drosophila_2:1626737_at:26:151; Interrogation_Position=188; Antisense; ACTTGGCCAGATTGCATCGTCGGAG
>probe:Drosophila_2:1626737_at:591:421; Interrogation_Position=213; Antisense; GAGACTGAGCTGGTGGTCCACATTG
>probe:Drosophila_2:1626737_at:722:601; Interrogation_Position=236; Antisense; TGTTCCTCTGGCTTAAGTTGCTACT
>probe:Drosophila_2:1626737_at:565:135; Interrogation_Position=269; Antisense; ACGACCTGTTATGTAGTGTGCCATT
>probe:Drosophila_2:1626737_at:516:191; Interrogation_Position=329; Antisense; AACTCGTGGCCTATGGAGTCCAACT
>probe:Drosophila_2:1626737_at:394:87; Interrogation_Position=345; Antisense; AGTCCAACTCTACTTTCAGCACGTG
>probe:Drosophila_2:1626737_at:286:649; Interrogation_Position=360; Antisense; TCAGCACGTGGCCAGTGTCTATGGA
>probe:Drosophila_2:1626737_at:158:607; Interrogation_Position=441; Antisense; TGAGGAACCTACCAACCTGGCTAGA
>probe:Drosophila_2:1626737_at:80:491; Interrogation_Position=511; Antisense; GTAAAGCTCTTTCAGCTGGGCATCT
>probe:Drosophila_2:1626737_at:519:535; Interrogation_Position=543; Antisense; GGTCCTTGGCAGCTTCGTTAATATA
>probe:Drosophila_2:1626737_at:422:597; Interrogation_Position=590; Antisense; TGTCCTACTATGTATCGCTGCATGG
>probe:Drosophila_2:1626737_at:383:271; Interrogation_Position=627; Antisense; CATATCCAATAACTGCCTAGTCCTG
>probe:Drosophila_2:1626737_at:539:89; Interrogation_Position=669; Antisense; AGTCATTTTGGCTGCTCATCTTTGC
>probe:Drosophila_2:1626737_at:347:271; Interrogation_Position=685; Antisense; CATCTTTGCCAGGTGAGGTCTGCTA

Paste this into a BLAST search page for me
ACTTGGCCAGATTGCATCGTCGGAGGAGACTGAGCTGGTGGTCCACATTGTGTTCCTCTGGCTTAAGTTGCTACTACGACCTGTTATGTAGTGTGCCATTAACTCGTGGCCTATGGAGTCCAACTAGTCCAACTCTACTTTCAGCACGTGTCAGCACGTGGCCAGTGTCTATGGATGAGGAACCTACCAACCTGGCTAGAGTAAAGCTCTTTCAGCTGGGCATCTGGTCCTTGGCAGCTTCGTTAATATATGTCCTACTATGTATCGCTGCATGGCATATCCAATAACTGCCTAGTCCTGAGTCATTTTGGCTGCTCATCTTTGCCATCTTTGCCAGGTGAGGTCTGCTA

Full Affymetrix probeset data:

Annotations for 1626737_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720