FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626738_at:

>probe:Drosophila_2:1626738_at:707:417; Interrogation_Position=3990; Antisense; GAGCGGCAGGGCATCACGTTTGTTT
>probe:Drosophila_2:1626738_at:129:31; Interrogation_Position=4002; Antisense; ATCACGTTTGTTTCGGTGCACGACT
>probe:Drosophila_2:1626738_at:230:15; Interrogation_Position=4107; Antisense; ATTTTGGAGCAGCTCTCCGAGTTCA
>probe:Drosophila_2:1626738_at:221:93; Interrogation_Position=4126; Antisense; AGTTCATGCGACATACCTACAGCTT
>probe:Drosophila_2:1626738_at:117:559; Interrogation_Position=4154; Antisense; GGACAGTGACTTCATCAACGATGGT
>probe:Drosophila_2:1626738_at:284:77; Interrogation_Position=4186; Antisense; AGGATCTGTCCAAGCGCCAGCTGAA
>probe:Drosophila_2:1626738_at:458:119; Interrogation_Position=4204; Antisense; AGCTGAACCGCATTCTGAAGCAGAT
>probe:Drosophila_2:1626738_at:298:373; Interrogation_Position=4235; Antisense; GAAGGGAGACTTTGACCTGCGCAAC
>probe:Drosophila_2:1626738_at:34:197; Interrogation_Position=4257; Antisense; AACGTGCTCGACTCAGTGTACTTCT
>probe:Drosophila_2:1626738_at:357:489; Interrogation_Position=4274; Antisense; GTACTTCTTCAGCTAGATGCGACTC
>probe:Drosophila_2:1626738_at:575:445; Interrogation_Position=4289; Antisense; GATGCGACTCAAACAACAGTGCCTA
>probe:Drosophila_2:1626738_at:684:265; Interrogation_Position=4305; Antisense; CAGTGCCTAGGCTTAATCGTAGTCA
>probe:Drosophila_2:1626738_at:461:397; Interrogation_Position=4401; Antisense; GACAGAAGCTACACGAGGCGCCAAA
>probe:Drosophila_2:1626738_at:685:641; Interrogation_Position=4430; Antisense; TCTGCGCCAGATGTGATTTTGTAAC

Paste this into a BLAST search page for me
GAGCGGCAGGGCATCACGTTTGTTTATCACGTTTGTTTCGGTGCACGACTATTTTGGAGCAGCTCTCCGAGTTCAAGTTCATGCGACATACCTACAGCTTGGACAGTGACTTCATCAACGATGGTAGGATCTGTCCAAGCGCCAGCTGAAAGCTGAACCGCATTCTGAAGCAGATGAAGGGAGACTTTGACCTGCGCAACAACGTGCTCGACTCAGTGTACTTCTGTACTTCTTCAGCTAGATGCGACTCGATGCGACTCAAACAACAGTGCCTACAGTGCCTAGGCTTAATCGTAGTCAGACAGAAGCTACACGAGGCGCCAAATCTGCGCCAGATGTGATTTTGTAAC

Full Affymetrix probeset data:

Annotations for 1626738_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720