Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1626740_at:

>probe:Drosophila_2:1626740_at:369:551; Interrogation_Position=1029; Antisense; GGAGAATGCTCGTCAGATCTCATCT
>probe:Drosophila_2:1626740_at:19:453; Interrogation_Position=1044; Antisense; GATCTCATCTGATCGCGATGGCGAT
>probe:Drosophila_2:1626740_at:26:453; Interrogation_Position=1102; Antisense; GATCTAAGCTCCAGCAGTTACCTGA
>probe:Drosophila_2:1626740_at:507:89; Interrogation_Position=1117; Antisense; AGTTACCTGAAACTCGGCGACTTGG
>probe:Drosophila_2:1626740_at:244:325; Interrogation_Position=1133; Antisense; GCGACTTGGCCAGTGCCGAGAAACT
>probe:Drosophila_2:1626740_at:64:587; Interrogation_Position=1172; Antisense; TGGACAACAGTGATCTCCGTGTGCC
>probe:Drosophila_2:1626740_at:229:631; Interrogation_Position=1187; Antisense; TCCGTGTGCCAATAGGTGCCTACTA
>probe:Drosophila_2:1626740_at:268:317; Interrogation_Position=1282; Antisense; GCCCTTAGTCGCAGTTTGTTGGTAA
>probe:Drosophila_2:1626740_at:508:433; Interrogation_Position=1385; Antisense; GAGTGACTATGACGTGTTTCCTAAG
>probe:Drosophila_2:1626740_at:610:373; Interrogation_Position=865; Antisense; GAAGATCGCCGTCAGGACCTAAGAA
>probe:Drosophila_2:1626740_at:87:211; Interrogation_Position=896; Antisense; AAGAATCCCGTCAAGATCTGCTCCA
>probe:Drosophila_2:1626740_at:605:103; Interrogation_Position=921; Antisense; AGACCTGCGTCAAGATCTGCGCCAA
>probe:Drosophila_2:1626740_at:50:453; Interrogation_Position=946; Antisense; GATCTGCGTCAAGAACTGCGCCAGG
>probe:Drosophila_2:1626740_at:533:309; Interrogation_Position=977; Antisense; GCCAAGATCAGTCCCGAAACCAAGA

Paste this into a BLAST search page for me
GGAGAATGCTCGTCAGATCTCATCTGATCTCATCTGATCGCGATGGCGATGATCTAAGCTCCAGCAGTTACCTGAAGTTACCTGAAACTCGGCGACTTGGGCGACTTGGCCAGTGCCGAGAAACTTGGACAACAGTGATCTCCGTGTGCCTCCGTGTGCCAATAGGTGCCTACTAGCCCTTAGTCGCAGTTTGTTGGTAAGAGTGACTATGACGTGTTTCCTAAGGAAGATCGCCGTCAGGACCTAAGAAAAGAATCCCGTCAAGATCTGCTCCAAGACCTGCGTCAAGATCTGCGCCAAGATCTGCGTCAAGAACTGCGCCAGGGCCAAGATCAGTCCCGAAACCAAGA

Full Affymetrix probeset data:

Annotations for 1626740_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime